Virtual Library

Background:
Large cell carcinoma (LCC) is an uncommon lung tumor that arises predominantly in smokers and shares many features of solid adenocarcinoma (ADC). 40% of LCC/solid ADC harbor mutations in KRAS; EGFR and ALK alterations are rare in this tumor type. The majority of these tumors, however, lack one of the commonly queried oncogenic driver alterations, thus therapeutic options are limited for patients with this tumor type. Immunomodulatory therapies, including targeting PDL1, have shown promise in a variety of tumor types. Tumor neo-antigens, including those induced by smoking, are associated with mutational burden and may predict susceptibility to cytolytic immune response; in addition, high PDL1 expression in non small cell lung carcinoma has been associated with response to anti-PDL1 drugs. Given the high prevalence of smoking in patients with LCC and solid ADC, we hypothesize that these tumors may be amenable to immunomodulatory therapy and sought to define the frequency of PDL1 expression in tumors lacking an oncogenic driver mutation.

Methods:
This study was restricted to 27 LCC and solid ADC known to be negative for KRAS, EGFR, ALK and ROS1 alterations. Hybrid capture targeted next generation sequencing (NGS) on an Illumina HiSeq 2500 was performed using a cancer genomic assay to detect mutations, copy number variations (CNVs) and structural variants. The assay captures exonic sequences of 275 cancer genes and 91 introns across 30 genes for rearrangement detection. Findings were compared to an institutional cohort of 732 consecutive lung tumors sequenced on the same platform. Immunohistochemistry for PDL1 was performed using a rabbit monoclonal antibody (Cell Signaling Technologies) at 1:100 dilution following pretreatment with citrate buffer/pressure cooker and detected using the Envision + polymer system (DAKO). Immunostaining was considered positive in the tumor component or the inflammatory component if ≥5% of the cells showed membranous staining.

Results:
Of the 27 tumors tested, 26 were resected from smokers. NGS revealed an average of 14.9 mutations per case for LCC/solid ADC cohort versus 8.1 mutations in the overall cohort of lung tumors (p<0.0001). 11 cases (41%) were positive for PD-L1. 7 cases (26%) showed strong, diffuse staining (≥70% of cells) for PD-L1. The inflammatory component was positive for PD-L1 in 25 cases (93%). Two cases with strong expression of PD-L1 by immunohistochemistry (>90% of cells) showed focal amplification of CD274 by NGS.

Conclusion:
LCC and solid ADC are strongly associated with a smoking history and harbor a significantly higher average mutational burden than other lung tumors. 41% of LCC/solid ADC are positive for PDL1 by immunohistochemistry with 26% showing very strong PDL1 expression and nearly all cases showing some degree of positivity in the associated inflammatory infiltrate. In some cases, high PDL1 expression is associated with focal amplification of CD274, the gene encoding PDL1. These findings suggest that LCC/ solid ADC is likely to have smoking-associated neo-antigen expression and that PDL1-directed immunotherapies may be a promising therapeutic approach in this otherwise poorly-characterized lung tumor.

Background:
Inhibition of PD-L1 can lead to reactivation of tumor immunity and assist in cancer therapy. PD-L1 expression in tumor cells has been reported to correlate with clinicopathological parameters and prognosis in a variety of cancers including lung adenocarcinomas (ADC). However, it has not been well studied whether PD-L1 expression is altered along with tumor progression. In addition, little is known about the role of PD-L1 expression in predicting response to chemotherapy in ADC. Thus, we sought to compare PD-L1 expression in the main tumor and lymph node metastases of stage II and III ADC, and correlate PD-L1 expression with survival in patients who underwent adjuvant chemotherapy.

Methods:
The study cohort consisted of 109 ADC who underwent curative resection without neoadjuvant therapy and were diagnosed to have stage II or III disease. Of those, 60 cases received platinum-based adjuvant therapy and were followed at our institution. Immunohistochemistry for PD-L1 (E1L3N, 1:200, CST) was performed on sections of the primary tumor and/or metastatic lymph nodes and the primary tumor sections were also stained with CD8 (4B11, RTU, Leica Bond). Membranous staining of any intensity present in 5% or more of the tumor cells was deemed positive for PD-L1 expression. CD8+ tumor infiltrating lymphocytes (TILs) were evaluated using a 4-tier grading system (0-3). The PD-L1 expression in the primary tumor was correlated with that in lymph node metastases as well as clinicopathological parameters, including CD8+ TILs, and recurrence free survival (RFS).

Results:
Of the 109 cases, 53 (48.6 %) exhibited PD-L1 expression in the primary tumor, which was significantly associated with smaller tumor size, lower pT stage, nodal disease, solid-predominant pattern, the presence of tumor islands, necrosis and lymphovascular invasion, and increased CD8+ TILs (grade 2-3). Upon multivariate analysis, only increased CD8+ TILs remained significant (p=0.039). As for the primary – lymph node correlation, PD-L1 expression was seen in 57.6% of 59 N1 nodes, 53.1% of 32 N2 nodes, and 100% of one N3 node available for evaluation. The PD-L1 expression status was the same between the primary tumor and nodal metastases in the majority (76.3 % of N1 nodes, and 75.0% of N2; p<0.001 and p=0.005, respectively), and the upregulation of PD-L1 expression (positive expression was present in nodal metastasis with negative primary) was seen in only small fractions of the cohort (6.8% of N1 nodes and 9.3% of L2 nodes). Interestingly, PD-L1 expression in the primary tumor was associated with longer RFS in patients who underwent platinum-based adjuvant therapy (mean 84 months vs. 41 months in PD-L1 negative patients, p=0.016), but not in those without adjuvant therapy.

Conclusion:
PD-L1 expression in the primary tumor was associated with prominent CD8+ TILs as well as several adverse clinicopathological parameters including nodal disease, but PD-L1 expression in the nodal metastasis was similar to that in the primary tumor in the majority of cases. Although the evaluation was limited due to a small size of the cohort, PD-L1 expression in the primary tumor appears to be predictive of response to platinum-based adjuvant therapy.

Background:
Lung cancer is the leading cause of cancer death worldwide and most of the patients are diagnosed with advanced disease. Inflammatory components play a key role in tumor progression and survival. Neutrophils are increased in blood of patients with lung cancer and they are associated with poor clinical outcomes. CD47 is a protein which control cell communication, apoptosis, adhesion and proliferation and it has been found increased in cancer and related with phagocytosis evasion mechanism.The aim of this study was to evaluate CD47 expression levels on peripheral neutrophils, also assess the phenotype, apoptosis, activation state, reactive oxygen species production of neutrophils between patients with Non-Small Cell Lung Cancer (NSCLC) and healthy subjects.

Methods:
Fifty NSCLC patients (stage IIIB and IV) naive to treatment and 25 healthy subjects were analized for: CD47 peripheral blood expression, neutrophils phenotype and activation state, evaluation of apoptosis and phagocytosis by flow cytometry. Reactive oxygen species (ROS) production by circulating neutrophils upon stimulation with PMA was assessed by flow cytometry. For the phagocytosis assay, PMNC were labeled with CMFDA and were cultured in RPMI for 24 hrs. To obtain apoptotic target cells, 24h PMNC were labeled with Annexin-V. For the evaluation of phagocytosis, the neutrophils from NSCLC patients were co-cultured with THP-1 cells. The percentage of phagocytosis was assessed by flow cytometry.

Results:
Our results showed a lower percentage of total CD47 in peripheral blood cells in NSCLC patients compared to controls [P=0.042]. Mean Fluorescence Intensity (MFI) of CD47 was higher in patients [P<0.001]. The percentage of CD66b+ cells characterized as neutrophils was higher in patients as well as their MFI of CD47 [P< 0.001]. MFI of CD66b was higher in patients [P< 0.0178]. This would be related with a more activated state. We found that a higher disease stage (IIIB vs. IV) associated with a higher MFI of CD47 [P=0.020]. Plasma pro-inflammatory cytokines, was increased in patients compare to controls IL-6 (P<0.002), IL-8 (P<0.001), IL-12p70 (P<0.008), TNF (0.010) and IFN-g (P<0.001). MFI of CD47 >1635.5 was associated with a higher median Overall survival (P= 0.007). We found a decrease of AnnexinV+/7AAD+ in neutrophils of patients [P=0.0317]. Caspases 3 and 7 were found decreased in neutrophils of patients [P= 0.049]. Oxygen species (ROS) production of neutrophils upon PMA stimulation was increased in patients [P=0.029], suggesting it might play a role in immune effector function. Phagocytosis of apoptotic neutrophils by differentiated THP-1 cells was decrease in cancer patients cells (P=0.0445). Mean fluorescence Intensity of CD47 was increased after 24 hrs in patients [P=0.0408]. This result suggests that neutrophils from patients avoid being engulfed and this may be associated with overexpression of CD47.

Conclusion:
Taken together, these findings suggest that these are altered mechanisms by which neutrophils evade anti-tumor immune response and their increased expression of CD47 is a potential therapeutic target for NSCLC.

Background:
Recent evidence suggests that PD-L1 expression can be induced with radiotherapy and may be a mechanism for resistance to radiotherapy and immunotherapy. Sequentially assessing PD-L1 expression on cancer associated cells in circulation during treatment regimens may be a way to assess the efficacy of radiotherapy and immunotherapy in clinical trials. For this feasibility study, we evaluated the association of RAD50 induction, and PD-L1 expression, on CTCs and Cancer Associated Macrophage-Like Cells (CAMLs) in lung cancer patients (pts) before and during radiotherapy to determine expression changes of these markers.

Methods:
Eleven pts with stage I-IV lung cancer were included in this pilot study. Three pts received Stereotactic Body Radiation Therapy (SBRT) for stage I disease and 8 other pts received chemoradiation for stage II-IV disease. Baseline blood samples (7.5 ml) were drawn prior to the start of radiotherapy (T0) and a second blood sample was drawn at a follow up visit during radiotherapy; or for three pts, after completing SBRT (T1); for a total of 22 samples. Blood was processed using CellSieve™ microfiltration (Creatv Microtech), stained for cytokeratin 8, 18 & 19 and CD45, and imaged. Using the QUAS-R (Quench, Underivatize, Amine-Strip and Restain) technique to remove fluoresce signal, all cells were restained for RAD50-AlexaFluor550 and PD-L1-AlexaFluor 488, along with DAPI nuclear stain. The RAD50 foci numbers within nuclear regions were quantified. PD-L1 pixel intensity was measured by the ZenBlue software and grouped into 4 IHC groups: 0-negative (pixel average 0-215), 1-low (pixel average 216-300), 2-medium (pixel average 301-750), and 3-high (pixel average 751+).

Results:
There was at least one cytokeratin positive cell (i.e. CTC or CAMLs) found in each of the samples. Specifically CTCs were found in 82% of T0 and 64% of T1 samples, and CAMLs were found in 91% of T0 and 100% of T1 samples. RAD50 foci ranged from 0-16 per cell, with an average of 0.69 at T0 that increased to 3.46 at T1 (p=0.002) during radiotherapy. Distinctively, there were 6 pts with greater than 2 fold RAD50 foci increase at T1 and 5 pts with ≤ 2 fold induction. PD-L1 expression ranged from 34-2004 pixel intensity, with an average of 170 at T0 and 336 at T1 (p=0.08). Interestingly, 4 pts had no PD-L1 expression at T0 but an increase to 2 to 3+ at T1, 4 pts with low/no PD-L1 expression remained low at T1, and 3 pts had high PD-L1 expression that remained high or decreased at T1. There was no correlation between RAD50 induction and PD-L1 expression.

Conclusion:
Both RAD50 foci and PD-L1 expression were quantifiable in both CTCs and CAMLs, and had variable responses to radiotherapy +/- chemotherapy. These data suggest that sequential tracking of CTCs or immune-related cells from the primary lung tumor is feasible using microfiltration and potentially can serve as predictive biomarkers for cancer therapy.

Abstract not provided

Background:
Preclinical modeling of immunotherapeutics in PDX-bearing mice has been limited by the absence of a relevant immune microenvironment, as a highly immunosuppressive environment is often required for the implanted tumor to grow. Checkpoint inhibitors including anti-PD-1 and anti-PD-L1 antibodies (mAbs) are promising new treatments in non-small cell lung cancer (NSCLC). The creation of a PDX model system that supports human tumor growth and recapitulates the relevant genomics in NSCLC while providing the immune microenvironment necessary for anti-PD-1 and anti-PD-L1 mAb activity is critical for validation of combination checkpoint inhibitor strategies in NSCLC.

Methods:
Hematopoietic CD34+ progenitor stem cells (CD34+ HPC) were engrafted into the tail vein of sublethally irradiated NSG mice. A KRAS G12D PDX was assayed for PD-L1 expression by FACS (Biolegend; clone 29E. 2A3, San Diego CA) and implanted into Hu-CD34 NSG mice with > 25% Hu-CD45+ cells 12 weeks post CD34+ HPC injection. Multilineage engraftment of immune cell subsets was assayed in peripheral blood, spleen and tumor by FACS (CD45, CD3, CD4, CD8, CD19). PDX were treated with vehicle Q5D x 6, pembrolizumab (Merck, Whitehorse Station PA) 5 mg/kg Q5D x 6, and combination pembrolizumab and docetaxel (Hospira, Lake Forest) 10 mg/kg Q7D x4 at the same single agent dosages. Body weight and tumor growth were assessed twice weekly.

Results:
Hu-CD45+ cells were detected in peripheral blood, spleen and tumor by flow cytometry on single cell suspension. The majority of Hu-CD45+ cells were T-cells: CD3CD4+ (mean blood 50%, spleen 53%, tumor 52%) and CD3CD8+ (mean blood 14%, spleen 15%, tumor 39%). KRAS G12D tumor had 89% surface expression of PD-L1. No significant change in Hu-CD45+ cell composition was noted between the different treatment groups. Pembrolizumab both alone and in combination with docetaxel showed activity in KRAS G12D PDX with substantial tumor growth inhibition and decreased mean tumor volume at day 24 post-treatment.

Conclusion:
Multilineage engraftment of relevant immune cell subsets for PD-1 inhibition is present in the humanized immune-mouse (Hu-CD34 NSG). PD-1 inhibition in a KRAS G12D Hu-CD34 NSG with high PD-L1 expression demonstrated substantial tumor growth inhibition both alone and in combination with chemotherapy. Additional studies are underway exploiting the Hu-CD34 NSG mouse model for study of anti-PD-1/PD-L1 therapies in KRAS mutant and other important molecular subsets of NSCLC.

Background:
The WHO estimated that 1.6 million people died of lung cancer in 2012. Nivolumab, an anti-PD-1 immune checkpoint inhibitor, was FDA approved on March 4, 2015 for platinum-refractory, metastatic, squamous-cell NSCLC, based upon a RR to single agent nivolumab of ~15% and improved OS. Combinatorial strategies may enhance these outcomes. Increased tumor expression of T cell chemokines, such as CCL5 and CXCL10, is associated with a better response to immunotherapy. Furthermore, expression of T cell chemokines is strongly and positively associated with increased T cell infiltration and improved patient survival. Therefore, enhancement of expression of T cell chemokines may augment response to PD-1 blockade immunotherapy.

Methods:
FDA-approved oncology agents were utilized from the Approved Oncology Drugs Set (97 agents) from the Developmental Therapeutics program of NCI. LKR cells were plated in 96-well plates, and a viability assay was performed 48 hours after drug administration (Cell Counting Kit-8, Dojindo Laboratories). Mice were bred and housed in the animal facility at Moffitt Cancer Center. Cells were harvested in logarithmic growth phase after being cultured for less than 2 weeks. 1x10[6] LKR or 344SQ cells were injected s.c. and tumors were monitored for growth by measurements 2-3 times per week. Romidepsin was injected i.p. (2mg/kg) on days 14,16, and 18 after tumor inoculation. Anti-PD-1 was injected i.p. (300μg/mouse) on days 15, 17, and 19 after tumor inoculation. Relative tumor size between treatment groups was analyzed using the t test with Welch’s correction.

Results:
Histone deacetylase inhibitors (HDACi), including vorinostat, emerged as the only class of agents in a 97-drug screen capable of inducing expression of multiple T cell chemokines, including CCL5, CXCL9, and CXCL10, in mouse and human lung cancer cell lines and primary tumors. HDACi’s ability to induce T cell chemokine expression was dependent on both JAK-STAT and NF-kB pathways. HDACi (romidepsin) treatment of mice bearing LKR tumors did not substantially cause tumor shrinkage but significantly reduced growth (p<0.0001; final tumor volume). This effect of HDACi was completely T cell dependent. LKR tumor cells had low cell surface expression of PD-L1 but which was substantially increased by IFN-g. PD-1 blockade with mAb reduced tumor growth but rarely induced rejection. However, when PD-1 blockade was combined with HDACi, 9 out of 11 mice demonstrated complete tumor rejection. HDACi anti-tumor response correlated with T cell chemokine induction in tumors and greater presence of tumor-infiltrating lymphocytes (TILs). We next used a mouse tumor model (344SQ) that was relatively resistant to anti-PD-1 treatment. PD-1 blockade combined with HDACi significantly reduced growth of these tumors compared to untreated (p=0.0003), anti-PD-1 alone (p=0.01), or HDACi (p=0.004) alone treated mice.

Conclusion:
HDACi not only enhanced anti-tumor response against PD-1 blockade sensitive tumors (LKR), but also induced response against PD-1 blockade resistant tumors (344SQ). HDACi induces JAK-STAT and NF-kB dependent chemokine expression and may induce tumor-infiltrating lymphocytes. Thus, a Phase I/randomized Phase II clinical trial of vorinostat, an orally active, small molecule HDACi, plus pembrolizumab, an anti-PD-1 humanized monoclonal IgG4-kappa antibody, is planned in patients with immune therapy naïve and pre-treated metastatic NSCLC.

Background:
Myeloid cell infiltration of the tumor microenvironment is associated with decreased overall survival in multiple tumor types, including lung cancer. This myeloid cell infiltration represents a tissue component of the heterogeneous group of cells termed myeloid derived suppressor cells (MDSC), which can inhibit the endogenous anti-tumor response, direct angiogenesis, and promote tumor progression. In several studies of patients with non-small cell lung cancer (NSCLC), there is wide variation in the presence of myeloid cells in the tumor with increasing levels peripheral blood MDSC associated with poor survival. We have previously shown that CD14+ monocytes can be converted by the tumor microenvironment to an immune suppressive phenotype in non-Hodgkin lymphoma and glioblastoma. In this work, we expand on our earlier observations to include recruitment of CD14+ cells by lung cancer cell lines and their conversion to an immune suppressive phenotype. While most models of myeloid cells in the microenvironment describe the effects of these cells on non-malignant systems, we show that myeloid cells may have profound direct effects on the tumor.

Methods:
Human lung cancer cell lines were cultured and supernatants collected for ELISA. CD14+ cells were isolated from the peripheral blood of healthy volunteers using anti-CD14 immunomagnetic beads. Lung cancer cell lines and CD14+ cells were cocultured under a variety of low serum conditions with or without cisplatin. Changes in CD14+ cell HLA-DR expression and tumor cell survival were measured by flow cytometry. CD14+ cell migration through a permeable transwell membrane was measured in real time with live cell imaging.

Results:
Under normal culture conditions, 7 of 8 human lung cancer cell lines secreted detectable levels of CCL2, a major chemoattractant for monocytes, ranging from 30 to 10,000 pg/ml of CCL2 found in culture supernatants. CD14+ cells more robustly migrated towards cell lines with higher production of CCL2. The coculture system showed a differential impact on monocytes by the tested lung cancer cell lines which either reliably upregulated or downregulated CD14+ cell expression of HLA-DR. In 3 of 8 lung cancer cell lines, CD14+ cell HLA-DR was downregulated in a manner expected to promote local immune suppression. Under serum starvation conditions, one lung cancer cell line showed improved survival when cocultured with CD14+ cells. Similarly, coculture with CD14+ cells enhanced tumor survival of two cell lines after exposure to cisplatin.

Conclusion:
The studied lung cancer cell lines differ in the degree of CD14+ cell recruitment, CD14+ cell HLA-DR expression after coculture, and level of conferred survival benefit under stressful conditions. Taken together these results suggest that the variable myeloid involvement in lung cancer patients can be modeled using lung cancer lines. In addition, we have identified that for some tumors, monocytes confer a significant survival advantage that is not associated with immune or angiogenic responses. Future work is needed to explore the impact of CD14+ cells on lung tumor invasiveness, angiogenesis, and the mechanisms underlying these pro-tumor effects.

Background:
Immune checkpoint pathways including the PD-1/PD-L1 pathway are involved in tumor evasion from the immune system. Elevated PD-L1 expression in tumor cells inhibits tumor-infiltrating T cell function and may be associated with poor prognosis in lung cancer patients. There is increasing interest in developing immunotherapies that block the immunosuppressive effects of checkpoint pathways such as PD-L1, and identifying patients who may benefit from PD-L1 blockade. Activating KRAS mutations are common driver mutations in non-small cell lung carcinoma. Patients with mutated KRAS demonstrate less benefit from adjuvant chemotherapy and resistance to tyrosine kinase inhibitors. The effect of cancer cell driver mutations on immune checkpoint immune regulation is poorly understood. While recent clinical trials have suggested better response to PD-1 blockade in KRAS mutation subjects, it is unclear if this clinical finding is directly driven by KRAS regulating the PD-1/PD-L1 pathway with resultant improved efficacy to anti-PD-L1 immunotherapy or if the presence of a KRAS mutation is merely a surrogate marker of the overall mutational load and tumor immunogenicity. KRAS mutations are known to activate the RAF-MEK-ERK pathway. We hypothesize that KRAS mutation directly regulates the PD-1/PD-L1 pathway through ERK activation.

Methods:
Immortalized human bronchial epithelial cells (HBEC-vector control), KRAS–mutated (KRAS[v12]) HBEC cells (HBEC-KRAS), p53 knockdown HBEC cells (HBEC-p53), and p53 knockdown/KRAS mutated cells (HBEC-p53/KRAS) were used to assess mRNA and/or surface protein expression levels of immune checkpoints including Lag-3, Tim-3, PD-L1 and PD-L2 by real time-qPCR (RT-qPCR) and flow cytometry, respectively. HBEC-vector and HBEC-KRAS cells were treated with MEK (ERK kinase) inhibitor (PD0325901) at 1µM for 24hrs and evaluated for mRNA and surface protein expression of PD-L1. The premalignant HBEC cell lines were used instead of human lung cancer cell lines in order to assess the role of KRAS mutation in isolation without other mutations.

Results:
PD-L1 and PD-L2 mRNA levels increased 2.4 fold (p<0.001) and 3.6 (p<0.001) fold in comparing HBEC-KRAS to HBEC-vector (wild-type) cells, while Lag-3 and Tim-3 mRNA expression levels were unchanged. Based on mean fluorescence intensity on flow cytometry, cell surface PD-L1 protein expression level was 2.2 and 1.6 fold higher in HBEC-KRAS and HBEC-p53/KRAS, respectively, compared to HBEC-vector cells. There was no increase in surface PD-L1 expression in HBEC-p53 cells compared to HBEC-vector control, suggesting that p53 mutation did not alter PD-L1 expression in HBEC-p53/KRAS cells. With MEK inhibition, PD-L1 mRNA levels decreased 10 and 11 fold in HBEC-vector and HBEC-KRAS cells, respectively. Analogously, PD-L1 surface protein levels were reduced 2.7 fold in HBEC-vector and HBEC-KRAS cells, respectively. These findings suggest that ERK activation mediates intrinsic expression and KRAS mutation mediates over-expression of PD-L1 mRNA and protein.

Conclusion:
Here, we demonstrate that PD-L1 expression is elevated in premalignant KRAS mutated human bronchial epithelial cells, and ERK activation mediates constitutive and KRAS mutation driven up-regulation of PD-L1 in these cells. Our findings suggest that KRAS mutation may directly regulate the PD-1/PD-L1 immune checkpoint pathway. Further understanding of KRAS driven molecular pathways that modulate immune checkpoints may elucidate therapeutic targets for potential combinational drugs to PD-L1 inhibition.

Abstract not provided

Background:
As one of the novel therapy strategies, PD-L1 has been shown the function of down-regulating T-cell activation through receptor PD-1. Moreover, prognosis of cancer patients are based not only on tumor-related factors but also on host-related factors, particularly systemic inflammatory response. As significant indicators of patients’ inflammation status, circulating monocyte count, neutrophil ratio and lymphocyte ratio were proved as predictors of prognosis in various cancers. Squamous non-small cell lung cancer (NSCLC) revealed to be divergent clinical and molecular phenotypes compared with non-squamous NSCLC. Significantly, combining application of appropriate biomarkers in prognosis prediction is emerging its high importance in cancer research.

Methods:
Chart review was performed on 1286 consecutive patients, 156 of these patients were enrolled in the final analysis. Patients with squamous NCSLC were randomly assigned (2:1) centrally by computer into training group and validation group. Monocyte ratio, Neutrophils to Lymphocytes Ratio, PD-L1 immunostaining score and PD-1-positive stained tumor-infiltrating lymphocytes counts were assessed by Fisher’s linear discriminant analysis to discriminate if OS would exceeding 5 years. The final model was used to calculate the discriminant score in each study participant. And this prediction model was validated in a second set of squamous NCSLC patients. We internally validated the model using a cross-validation procedure.

Results:
4 independent predictors of OS were identified by using FLDA with stepwise variant-selection. The clinical classifying model was described by the following equation: Y = −1.212 + 0.211 × NLR ratio + 0.437 × monocyte ratio - 0.390 × PD-L1 + 0.035 × PD-1 (eigenvalue 0.673, canonical correlation 0.634, P < 0.001). In this equation, PD-L1 represented PD-L1 immunostaining score; and PD-1 represented PD-1 positive TILs counts. For the training set of 104 leave-one-out-cross-validated cases, 27 of 29 OS > 5 years (93.1% sensitivity) and 61 of 75 OS <= 5 years (81.3% specificity) were correctly classified with an overall accuracy of 84.6% (88 of 104) and an AUC of 0.938 [P < 0.001, 95% confidence interval (CI) 0.864–1] Next, the predicting model consisting of the 4 predictors (NLR ratio, monocyte ratio, PD-L1 and PD-1) were applied to the validation set of 52 patients (14 OS > 5 years and 38 OS <= 5 years). A survival prediction for 38 of the 52 patients (73.1%) with an AUC of 0.908 (P < 0.001, 95% CI 0.806–1) was achieved. Also, 12 of 14 OS > 5 years (85.7% sensitivity) and 26 of 38 OS <= 5 years (68.4% specificity) were correctly identified.

Conclusion:
The analysis of a set of immunological markers could effectively and reproducibly classify patients with squamous NCSLC according to their overall survival. Further prospective validation in larger independent cohorts of patients with similar or different regimens is warranted to fully assess its predictive power. The 4-immunological-marker model offers a novel tool for survival prediction and could have important clinical implications for the consideration of differential treatment strategies in patients with squamous NCSLC, thus providing a framework for future individualized therapy.

Background:
Inducible nitric oxide synthase (iNOS) and reactive nitrosylation are important mediators of tumor immunosuppression by myeloid-derived suppressor cells (MDSCs). However, the role of CD33+ peritumoral PMN-MDSCs in these pathways remains unclear. We conducted a retrospective cohort study of NSCLC subjects treated with surgery, with the primary objective to determine the association of MDSC biomarkers with time to progression (TTP) and overall survival (OS).

Methods:
Inclusion criteria: Surgically treated NSCLC of all stages at a single institution between 1996 and 2010. Somatic mutations tested by PCR. Anti-human antibodies optimized for immunohistochemistry. Samples scored by blinded pathologist based on intensity and percentage of peritumoral cells. Peritumoral nitrotyrosine (NT) and iNOS used Allred scoring. Time to progression (TTP) defined as time from resection to progression event or censored at last evaluation. Overall survival (OS) defined as time from resection to death.

Results:
Of 458 tumor samples, 366 lung primaries, 38 soft tissue metastases, and 39 brain metastases. Demographics: median age 67 yrs, 54% female, 96% Caucasian. Of 151 tested for somatic mutations, 36% KRASm, 8.6% EGFRm, 25% p53m, respectively. Histology: adenocarcinoma 76%, squamous 10%. Higher % CD3+ tumor infiltrating lymphocytes (TILs) and CD33+ myeloid cells were observed in tumors than normal tissue (p < .0001 and p = .002, respectively). More CD3+ TILs observed in soft tissue metastases than primary lung tumors (p < .0001). No difference in iNOS expression between tumor and normal lung tissue. More CD3+ TIL was observed in p53 mutant tumors (p=.03). iNOS was positively correlated with CD3+ TIL (p < .001) and CD73+ epithelial cells (p <.001), but not CD33+ myeloid cells. NT expression correlated with the absence of CD3+ TIL (p = .02), consistent with its putative immunosuppressive activity. Median TTP: 10.4 months; 320 (69.7%) events. Median OS: 35.4 months; 353 (77.1%) events. Expectedly, presence of CD3+ TIL was associated with favorable OS; HR 0.5 [0.4 – 0.7], p < .0001, and TTP; HR 0.7 [.5 – .9], p =.009. CD33+ myeloid cells were associated with favorable OS; HR 0.6 [0.5-0.8], p = .0002. Presence of peritumoral iNOS trended toward favorable OS; HR 0.81 [0.6-1.0], p = .07. Peritumoral iNOS was not associated with TTP. Figure 1



Conclusion:
Increased presence of TILs in p53 mutant tumors has been reported in other cancers, and may be related to somatic mutational load. An inflamed tumor phenotype was associated with improved overall survival. Unexpectedly, iNOS was positively correlated with both CD3+ infiltration and overall survival.

Background:
Cancer development and biology is influenced by the host immune system. Emerging data indicate that the context of immune cell infiltrates within the tumor is associated with cancer prognosis. Both the activation state and type of immune cells present can provide mediators that either promote or inhibit tumor growth. While the presence of activated cytotoxic T lymphocytes (CTL) may correlate with better patient survival, the presence of tumor associated macrophages and effector lymphocytes that lack cytotoxic properties may promote tumor growth. Thus, in established tumors, a balance between pro and anti-tumor mediators are present, but as advanced tumors rarely regress without therapeutic intervention, this balance is likely skewed towards tumor-promoting inflammation. In attempts to gain insight into the immune networks that regulate tumorigenesis, we used genome wide gene expression datasets of primary lung cancer tissues to identify and functionally validate immune related genes that are associated with patient survival.

Methods:
Gene expression analysis was conducted on microarray datasets from 128 early-stage NSCLC resected tumor samples. Limiting analysis to immune-related gene sets curated by NIAID ImmPortal, we identified a minimum gene set using MAximizing R Square Algorithm (MARSA) that selected for the greatest separation between good and poor prognostic patient subgroups. The prognostic value of this gene signature was validated in nine additional independently published microarray datasets of NSCLC. From the gene signature, we functionally characterized the potential role of the soluble protein LAIR2 in immune regulation of lung cancer.

Results:
We identify a 9-gene signature that separate patients into high and low-risk subgroups for 5-year cancer-free survival (hazard ratio 10.26, 95% confidence interval 4.32-24.34, p<0.0001). The prognostic accuracy of this signature was validated in additional NSCLC datasets (total 1095 patients without adjuvant treatment). Amongst the 9-genes, the gene encoding the soluble protein LAIR2 was highly expressed within the high-risk patient subgroup. Functionally, we found that addition of recombinant LAIR2 resulted in increased NK cell expression of cytotoxicity receptors and secretion of pro-inflammatory cytokines in the presence of lung cancer cell lines.

Conclusion:
By limiting gene expression analysis to immune related genes, we identify a 9-gene prognostic immune signature in resected early stage NSCLC patients. The signature identifies a role for the soluble protein LAIR2 in the modulation of immune cell activation during lung cancer development and may suggest that LAIR2 induce a pro-inflammatory microenvironment which promote tumorigenesis and poor patient outcome.

Abstract not provided

Background:
Nedaplatin (N) is a second-generation platinum compound with lower nausea/vomiting and nephrotoxicity than cisplatin (C). Nedaplatin plus docetaxel (ND) showed a promising efficacy with acceptable toxicity for advanced squamous cell lung cancer (SqLC) in the previous phase II study.

Methods:
Eligible patients (pts) were those with pathologically proven SqLC with stage IIIB/IV or postoperative recurrence, aged 20-74 years and ECOG PS 0-1. Pts were randomized 1:1 to ND (N 100 mg/m[2] and docetaxel (D) 60mg/m[2] iv, q3w, up to 6 cycles) or C plus D (CD) (C 80 mg/m[2] and D 60mg/m[2] iv, q3w, up to 6 cycles) according to stage, gender and institution. The primary endpoint was overall survival (OS), and secondary endpoints included progression-free survival (PFS), response rate (RR) and adverse events (AEs). Target sample size of 350 provided 90% statistical power to detect a hazard ratio of 0.71 with one-sided type I error of 0.05.

Results:
Between July 2009 and July 2012, 355 pts were randomized. Of 349 for efficacy analysis (ND 177; CD 172), baseline characteristics were well-balanced between two arms. ND had a significantly longer OS (p=0.037, one-sided stratified log-rank test). The OS HR was 0.81 (90%CI, 0.67-0.98) with a median OS of 13.6 months [m] for ND and 11.4 for CD. ND had a longer PFS (p=0.050) with a HR of 0.83 (0.69-1.00) and a median PFS of 4.9 m in ND and 4.5 in CD. RR was 54.5% in ND vs 52.9% in CD (p=0.829). Grade 3 or higher AEs of nausea (4.0% vs 14.3%), fatigue (3.4% vs 10.9%), hyponatremia (13.6% vs 30.3%) and hypokalemia (2.3% vs 8.6%) are more frequent in CD. Grade 3 or higher AEs of neutrophils (82.5% vs 70.3%) and platelets (9.0% vs 0.0%) are more frequent in ND, but there was no difference in grade 3 or higher febrile neutropenia (13.6% vs 15.4%). Treatment related deaths occurred in 4 and 3 pts in ND and CD, respectively.

Conclusion:
ND showed a significantly longer OS as compared to CD with different toxicity profile. ND will be considered as a new standard treatment for advanced or relapsed SqLC. Clinical trial information: UMIN000002015.

Background:
Sacituzumab govitecan (IMMU-132) is a new Antibody Drug Conjugate (ADC) comprising SN-38, the active metabolite of the topoisomerase I inhibitor, camptothecin (irinotecan), conjugated to an anti-Trop-2 humanized antibody at a high drug-antibody ratio (7.6). In vitro and in vivo preclinical data suggest that IMMU-132 delivers up to 136-fold more SN-38 than its parental drug, irinotecan, in a human cancer xenograft. Trop-2 is widely expressed in most epithelial cancers, including non-small and small-cell lung cancers (NSCLC and SCLC).The safety and efficacy of this new ADC is being examined in advanced metastatic lung cancers.

Methods:
A Phase II clinical trial (ClinicalTrials.gov, NCT01631552) is ongoing in subsets of previously-treated patients with metastatic lung cancer, administering IMMU-132 on days 1 and 8 of 21-day treatment cycles. A phase 1 run-in phase selected 8 and 10 mg/kg weekly dosage as safe for tumor cohort phase 2 expansion. Treatment is continued based on tolerance or until progression, with safety and response assessments made every week and 8-12 weeks, respectively.

Results:
Forty-four lung cancer patients were given IMMU-132 doses at 8 mg/kg (N = 23) or 10 mg/kg (N = 21); 38 patients (18 NSCLC and 20 SCLC) are assessable for efficacy. Patients were heavily pretreated (median of 3 prior lines). Objective tumor responses (all partial responses by RECIST1.1) and median progression-free survival (PFS) are reported below per tumor. These studies are being expanded.

Tumor type	Prior lines of therapy: median (range)	Objective Response Rate (PR)	Median PFS (maturity) in months
NSCLC (N=18)	3 (1-8)	33%	5.4 (56%)
SCLC (N=20)	2.5 (1-7)	25%	2.4 (70%)

IMMU-132 was well tolerated with limited grade 3/4 toxicities above the 3% threshold per patient. Neutropenia was the only Grade 3/4 toxicity (G3, 14%; G4, 7%) together with hyponatremia (G3, 2%; G4, 2%). Other drug-related G3 toxicities included diarrhea (7%), anemia (5%), leukopenia (5%), hyperglycemia (5%) and atrial fibrillation (5%); no patient developed antibodies to the conjugate.

Conclusion:
Repeated cycles of IMMU-132 monotherapy are well tolerated. Objective response rate and progression-free survival data in previously-treated metastatic lung cancer (5.4 months in NSCLC) are encouraging and warrant further evaluation of IMMU-132 in these lung cancers.

Background:
Vintafolide (folic acid-vinca alkaloid conjugate) binds to the folate receptor (FR), which is overexpressed in approximately 80% of patients with NSCLC, including patients with squamous cell and adenocarcinoma. Using the molecular imaging agent 99mTc-etarfolatide for SPECT imaging, the FR status of malignant lesions can be determined. Vintafolide has demonstrated single agent activity in patients with advanced NSCLC whose tumors all expressed FR [FR(100%)] compared to patients not FR(100%) (Edelman et al, 2012).

Methods:
This study randomized patients with advanced NSCLC whose tumors were FR(100%) to vintafolide, vintafolide + docetaxel, or docetaxel. Key eligibility criteria: age ≥18 years; 1 prior systemic therapy for advanced disease; ECOG PS 0-1. Patients underwent [99m]Tc-etarfolatide SPECT screening for FR assessment. Vintafolide (2.5 mg) was administered on days 1, 4, 8, 11 every 21 days and docetaxel (75 mg/m[2]) on day 1 every 21 days. The primary endpoint was progression-free survival (PFS). Pre-specified PFS comparisons were performed for vintafolide vs docetaxel and vintafolide+docetaxel vs docetaxel in all patients as well as those with adenocarcinoma. Significance testing for each PFS analysis was one-sided without adjustment for multiplicity (alpha=0.10). Overall survival (OS) was a secondary endpoint.

Results:
Over 14 months, 199 FR(100%) patients were randomized and treated (vintafolide: 63; vintafolide+docetaxel: 68; docetaxel: 68). Patient and disease characteristics were well-balanced between arms. The vintafolide+docetaxel arm met the primary endpoint of superior PFS over the docetaxel arm in all patients regardless of histology (17.0% censored; unstratified Cox model hazard ratio [HR] =0.75; unstratified one-sided p-value=0.0696) as well as in the prespecified 133 patient adenocarcinoma subgroup (18.8% censored; HR=0.73; p-value=0.0899). Trends in OS favored the vintafolide+docetaxel arm over the docetaxel arm in all patients (37.7% censored; HR=0.88; p-value=0.2874) and showed the greatest benefit in the adenocarcinoma subgroup (42.8% censored; HR=0.70; p-value=0.1018). The single-agent vintafolide arm was not superior to docetaxel. Vintafolide+docetaxel treatment was associated with more neutropenia (all grades: 77% versus 62%), febrile neutropenia (13% versus 6%), and peripheral neuropathy (34% versus 21%) compared to docetaxel alone.

Conclusion:
The addition of vintafolide to docetaxel resulted in a statistically significant improvement in PFS in FR(100%) NSCLC patients regardless of histology (PFS HR= 0.75) and in the adenocarcinoma subset (PFS HR= 0.73). Additionally, there was a trend towards improvement in OS in all patients regardless of histology (OS HR= 0.88) and in the adenocarcinoma subset (OS HR= 0.70). Vintafolide +docetaxel was generally well tolerated, although rates of neutropenia, neutropenic fever, and neuropathy were higher than with docetaxel alone. Final survival results will be presented at the conference.

Abstract not provided

Background:
L‑DOS47, a cancer therapeutic designed to exploit the acidic tumour extracellular environment, is a protein conjugate consisting of a urease conjugated to a camelid monoclonal antibody (AFAIKL2) that is targeted to the CEACAM6 antigenic tumour marker. The AFAIKL2 antibody serves as a targeting agent to deliver the enzyme to the tumor sites while the urease enzyme converts urea, an abundant natural metabolite, into ammonia and generates a local pH increase. The combined effect of ammonia toxicity and pH increase is cytotoxic to cancer cells in culture and in xenograft models. This first in human study of L‑DOS47 was designed to define the maximum tolerated dose of multiple doses of L-DOS47 administered intravenously to patients with non-squamous NSCLC when given as a monotherapy.

Methods:
Stage IIIb or IV histologically confirmed non-squamous NSCLC patients (aged ≥18 yrs, ECOG PS ≤2) receive multiple cycles of L-DOS47 during the study treatment period. L-DOS47 is administered once weekly over 14 days followed by 7 days rest in each treatment cycle. Patients are recruited into cohorts and received the same dose of L-DOS47 on Days 1 and 8 of each treatment cycle. Dose levels of L-DOS47 are escalated in further cohorts following a review of safety data by the Trial Steering Committee.

Results:
Thirty-three (33) pts (median age 61, 58% male) were enrolled in the first ten cohorts (dose levels: 0.12, 0.21, 0.33, 0.46, 0.59, 0.78, 1.04, 1.38, 1.84, 2.45 µg/kg) in four Polish centers. L-DOS47 was well tolerated at the dose levels reviewed. No DLTs were reported. Adverse events reported to date were expected for the population under study. None of the patients treated to date have had a partial or complete response as defined by RECIST v1.1. Sixteen (16) patients had an overall response of stable disease after completing two cycles of L-DOS47. One patient in cohort 9 was dosed for 9 cycles without disease progression.

Conclusion:
L-DOS47 monotherapy is well tolerated at dose levels up to 2.45 µg/kg. ClinicalTrials.gov identifier: NCT02340208

Background:
Platinum-based doublet chemotherapy is the standard chemotherapeutic regimen for treatment-naïve advanced non-small cell lung cancer (NSCLC). S-1, an oral fluoropyrimidine, combined with carboplatin or cisplatin (CDDP) has demonstrated the non-inferiority to the standard platinum doublet chemotherapy in Japanese NSCLC patients. However, its effectiveness in Chinese NSCLC patients is uncertain. The purpose of this study is to compare the efficacy and safety of these chemotherapeutic regimens in Chinese NSCLC patients.

Methods:
We did this randomized controlled study in 21 sites in China. Eligible patients were those aged 18-70 years who was histologically or cytologically confirmed with locally advanced or metastatic NSCLC with no prior radiotherapy, molecular targeted therapy or chemotherapy. Patients were randomized to receive either S-1 orally 80 mg/m[2]/day (40 mg/m[2]2 b.i.d., 80–120 mg/day) with 60 mg/m[2] CDDP on day 8 every 5 weeks (SP) or docetaxel and CDDP (both 75 mg/m[2]) on day 1 every 3 weeks (DP) for up to 6 cycles. Randomisation was stratified by centre, pathological classification, disease stage and gender. The primary endpoint was progression free survival (PFS), analyzed in the full analysis set. The study is registered at ClinicalTrials.jp, number Japic CTI-111479.

Results:
Between March 2011 and November 2012, 246 patients from 21 institutions in China were randomly assigned and received SP or DP treatment (124 vs 122) with 18-month follow-up period from the last patient randomized. In the SP and DP group, median PFS was 5.9 and 5.7 months (HR=0.68; 95% CI, 0.48-0.96) respectively, median overall survival was 19.1 and 14.8 months, respectively (HR=0.84; 95% CI, 0.61-1.14). The most common grade 3 or worse adverse events in both treatment groups were neutropenia 3.3% vs 55.1%, leukopenia 1.7% vs 39.0%, and febrile neutropenia 0.8% vs 5.9%, of 121 patients in the SP group and of 118 patients in the DP group, respectively.

Conclusion:
The efficacy of SP was non-inferior to DP with a better safety profile. SP would be a new standard first-line chemotherapy regimen for Chinese patients with advanced NSCLC.

Abstract not provided

Background:
Treatment options for patients with advanced SQ NSCLC who fail platinum-based doublet chemotherapy (PT-DC) are limited. NIVO, a fully human IgG4 programmed death-1 (PD-1) immune checkpoint inhibitor, demonstrates activity across NSCLC histologies and is approved in the US for treatment of metastatic SQ NSCLC with progression on or after platinum-based chemotherapy. We report results from a randomized, open-label, global phase 3 study (CheckMate 017; NCT01642004) comparing NIVO vs docetaxel in patients with previously treated SQ NSCLC and disease progression during/after one prior PT-DC regimen.

Methods:
Patients (N=272) were randomized 1:1 to receive either NIVO 3 mg/kg every 2 weeks (Q2W; n=135) or docetaxel 75 mg/m[2] Q3W (n=137) until disease progression or discontinuation due to toxicity or other reasons. For NIVO patients, treatment after initial progression was permitted at the investigator’s discretion, per protocol criteria. The primary objective was overall survival (OS). Secondary objectives included investigator-assessed objective response rate (ORR; per RECIST v1.1), progression-free survival (PFS), efficacy by PD-L1 expression (PD-L1 testing not required for enrollment), patient-reported outcomes (PRO), and safety. PRO analyses are presented in a separate abstract.

Results:
Treatment with NIVO led to 41% reduction in risk of death (hazard ratio [HR]=0.59; 95% CI: 0.44, 0.79; P=0.00025) and improved ORR (20% vs 9%; P=0.0083) and PFS (HR=0.62; 95% CI: 0.47, 0.81; P=0.0004) vs docetaxel (Table). Twenty-eight patients were treated with NIVO beyond initial progression, nine of whom demonstrated a non-conventional pattern of benefit (ie, reduction in target lesions with simultaneous appearance of new lesions, initial progression followed by tumor reduction, or no further progression for ≥2 tumor assessments). Across pre-specified cut-points (1%, 5%, and 10%), PD-L1 expression was neither prognostic nor predictive of benefit. OS HRs favored NIVO across most predefined patient subgroups. Grade 3–4 drug-related adverse events (AEs) were reported in 7% (9/131) of NIVO and 55% (71/129) of docetaxel patients. Grade 3–4 drug-related select AEs are shown below (Table). No deaths were related to NIVO vs 3 docetaxel-related deaths. Figure 1



Conclusion:
CheckMate 017 achieved its primary objective, demonstrating clinically superior and statistically significant OS with NIVO vs docetaxel in patients with advanced, previously treated SQ NSCLC. Benefit was seen regardless of PD-L1 status. The safety profile of NIVO 3 mg/kg Q2W is favorable vs docetaxel and consistent with prior studies. AEs were manageable with established guidelines. NIVO represents a new standard of care in this patient population. Updated OS and safety data will be presented.

Background:
Nivolumab (NIVO), a fully human IgG4 programmed death-1 (PD-1), immune checkpoint inhibitor antibody, has demonstrated durable responses and tolerability in heavily pretreated patients with advanced non-small cell lung cancer (NSCLC). NIVO was recently approved for the treatment of patients with metastatic squamous (SQ) NSCLC with progression on or after platinum-based chemotherapy. Conducted mostly in community-based oncology centers, this ongoing trial explores the safety of NIVO in patients with previously-treated PD-L1[+/-] metastatic SQ or non-squamous (NSQ) NSCLC.

Methods:
Eligible patients are enrolled in 4 subgroups: 1) SQ, performance status (PS) 0–1, ≥2 prior therapies; 2) SQ, PS 0–1, 1 prior therapy; 3) NSQ, PS 0–1, ≥1 prior therapy; and 4) SQ or NSQ, PS 2, ≥1 prior therapy. Patients with both PD-L1[+] and PD-L1[-] tumors are eligible. Patients receive NIVO 3 mg/kg IV (60 minutes) Q2W either until progressive disease (PD)/unacceptable toxicity (Cohort A) or for 1 year with the possibility of retreatment upon disease progression (Cohort B). Primary objective is to estimate incidence of high-grade (CTCAE v4.0 Grade 3–4 and 5), select treatment-related adverse events (STRAEs); exploratory efficacy assessments include ORR, PFS, and OS.

Results:
From 4/16/14 to 12/31/14, 824 patients were treated and have demographic and safety data available; 483 patients remained on study as of 12/31/2014. 395 patients had evaluable radiographic tumor assessments at first assessment (Week 9). Demographics, safety, and tumor response by PD-L1 status are reported. Figure 1



Conclusion:
Safety and tolerability are consistent with prior NIVO experience and no new safety signals have been identified in this trial of SQ/NSQ NSCLC patients. Immune-related toxicities are manageable in a community practice setting using previously-developed safety algorithms. The frequency of STRAEs of interest was similar between patients with PS 0–1 and those with PS 2. Early data from this large, multicenter trial suggests that patients with pretreated advanced NSCLC benefit from NIVO therapy regardless of tumor PD-L1 status, histology type, and PS status.

Background:
Patients with advanced, refractory squamous (SQ) non-small cell lung cancer (NSCLC) have historically poor outcomes and limited treatment options. Nivolumab (NIVO), a fully human IgG4 programmed death-1 (PD-1) immune checkpoint inhibitor antibody, has activity across NSCLC histologies and is FDA-approved for treatment of metastatic SQ NSCLC with progression on or after platinum-based chemotherapy. We report efficacy, safety, and biomarker analyses from a phase 2, single-arm study of NIVO in patients with SQ NSCLC who progressed during/after prior platinum-based doublet chemotherapy and ≥1 additional systemic regimen.

Methods:
Patients (N=117) received NIVO 3 mg/kg every 2 weeks until progressive disease (PD)/unacceptable toxicity; treatment beyond PD was permitted per protocol. The primary endpoint was independent radiology review committee (IRC)-assessed objective response rate (ORR), per RECIST v1.1. Additional objectives included investigator-assessed ORR, progression-free survival (PFS), overall survival (OS), safety, ORR by patient subgroups, efficacy by tumor PD-L1 expression (PD-L1[+]: ≥5% tumor cells expressing PD-L1), and blood-based biomarker analyses (measurement of circulating microRNA and cytokines).

Results:
IRC-assessed ORR was 15% (95% CI: 9, 22), with a minimum of 11 months follow-up. Median duration of response was not reached (range, 2+–12+ months); 76% (13/17) of patients had ongoing responses. Objective responses were observed across patient subgroups and regardless of PD-L1 expression (Table). Four of 22 patients treated beyond PD demonstrated a non-conventional pattern of benefit (ie, persistent reduction in target lesions in the presence of new lesions, regression following initial progression, or no further progression for ≥2 tumor assessments); OS for these patients was 6.6, 11.6+, 12.9+, and 13.5+ months. The 1-year OS rate was 41% (95% CI: 32, 50) and median OS was 8.2 months (95% CI: 6.1, 10.9). The 1-year PFS rate was 20% (95% CI: 13, 29); median PFS was 1.9 months (95% CI: 1.8, 3.2). Peripheral increases in serum IFN-γ-stimulated cytokines, including CXCL9 and CXCL10, were observed, and preliminary microRNA analyses identified altered gene expression following NIVO treatment. Grade 3–4 treatment-related adverse events occurred in 17% of patients, including fatigue (4%), diarrhea (3%), and pneumonitis (3%). Pneumonitis was manageable with corticosteroids; median time to resolution was 3.4 weeks (range, 0.7–13.4). Two treatment-related deaths (1 hypoxic pneumonia, 1 ischemic stroke) occurred in patients with multiple comorbidities and concurrent PD. Figure 1



Conclusion:
NIVO demonstrated clinically meaningful efficacy and an acceptable safety profile in patients with advanced, refractory SQ NSCLC. Updated 18-month OS, safety, and biomarker analyses will be presented.

Abstract not provided

Background:
Combined blockade of the PD‐1 and cytotoxic T‐lymphocyte‐associated antigen‐4 (CTLA‐4) immune checkpoint pathways has shown improved responses, encouraging survival rates, and a manageable safety profile in advanced melanoma. NIVO, a fully human IgG4 PD-1 immune checkpoint inhibitor antibody, has activity across NSCLC histologies and is approved in the US for treatment of metastatic squamous (SQ) NSCLC with progression on or after platinum-based chemotherapy. This phase 1 study evaluated the safety and efficacy of first‐line therapy with NIVO plus ipilimumab (IPI), an IgG1 CTLA‐4 checkpoint receptor blocking antibody, in chemotherapy‐naïve patients with advanced NSCLC.

Methods:
Patients (N=49) received NIVO plus IPI at the 1+3 mg/kg or 3+1 mg/kg combination dose, respectively (one SQ and one non‐SQ cohort per dose level), every 3 weeks for 4 cycles, followed by NIVO 3 mg/kg every 2 weeks until progression or unacceptable toxicity. Objective response rate (ORR; RECIST v1.1) was evaluated overall and by baseline tumor PD‐1 ligand 1 (PD‐L1) expression (PD‐L1[+]: ≥5% tumor cells expressing PD‐L1). Response was assessed at weeks 10, 17, and 23, and every 3 months thereafter until progression.

Results:
Median follow‐up for all patients was 50 weeks. Across histologies, confirmed ORR was 13% (3/24) for NIVO1+IPI3 and 20% (5/25) for NIVO3+IPI1. Two of 3 and 4/5 responders in the NIVO1+IPI3 and NIVO3+IPI1 arms, respectively, achieved a response by first scan. Median duration of response was not reached (NR) in either group, and responses were ongoing in 67% (2/3) and 60% (3/5) of patients treated with NIVO1+IPI3 and NIVO3+IPI1, respectively. Two patients in the NIVO3+IPI1 group exhibited an unconventional “immune-related” response with 56% and 64% maximum reductions in target lesions and simultaneous appearance of new lesions. The 24-week progression-free survival (PFS) rates and median PFS were 44% and 16.1 weeks, respectively, for NIVO1+IPI3 and 33% and 14.4 weeks, respectively, for NIVO3+IPI1. One-year overall survival (OS) rates and median OS were 65% and NR, respectively, for NIVO1+IPI3 and 44% and 47.9 weeks, respectively, for NIVO3+IPI1. Thirty-eight of 49 treated patients were evaluable for PD-L1 expression; objective responses were observed in PD‐L1[+] (19%, 3/16) and PD‐L1[-] (14%; 3/22) patients. Across arms, grade 3–4 treatment-related adverse events (AEs) were reported in 25 patients (51%); grade 3 pneumonitis was reported in 3 (6%) patients. Treatment‐related AEs led to discontinuation in 18 patients (37%); 15 (31%) patients discontinued treatment during induction. Treatment‐related deaths (n=3) were due to respiratory failure, bronchopulmonary hemorrhage, and toxic epidermal necrosis.

Conclusion:
Treatment with NIVO plus IPI was associated with durable responses and encouraging survival regardless of tumor PD-L1 expression. The safety profile was managed using established safety guidelines. Updated OS and results from additional doses and schedules will be presented.

Background:
PD-L1 expression on tumor-infiltrating immune cells (IC) and/or tumor cells (TC) can inhibit antitumor immunity. Atezolizumab (MPDL3280A) is an anti-PDL1 antibody that has shown efficacy across multiple tumor types. The efficacy and safety of atezolizumab in the Phase 2 FIR study has been reported previously (Spigel et al, ASCO 2015). Efficacy appeared to correlate with PD-L1 expression on IC and/or TC, with higher ORRs observed in patients with the highest expression of PD-L1, indicating that PD-L1 may be a predictive biomarker for response to atezolizumab. FIR was also designed to address questions of potential heterogeneity and changes in tumor PD-L1 expression in metachronous tissue samples, as well as the utility of using FDG-PET as a biomarker for response to atezolizumab in PD-L1–selected patients with NSCLC.

Methods:
FIR is a 3-cohort, single-arm, Phase 2 study of atezolizumab in PD-L1–selected patients with stage IIIB/IV NSCLC. Cohort 1 included chemo-naive patients, Cohort 2 included ≥ 2L patients without a history of brain metastases, and Cohort 3 included ≥ 2L patients with asymptomatic treated brain metastases. PD-L1 expression was centrally assessed by immunohistochemistry (IHC) using the SP142 antibody assay in archival and/or fresh tumor biopsies or resections and scored as IC0, 1, 2 or 3 and TC0, 1, 2 or 3. Patients with PD-L1 IC2/3 or TC2/3 tumors were enrolled and received 1200 mg atezolizumab IV every 3 weeks (last patient entered Jun 27, 2014). Responses were measured by RECIST v1.1, modified RECIST and FDG-PET using EORTC criteria. Exploratory objectives included the evaluation of potential predictive biomarkers, including the comparison of PD-L1 expression in matched archival and fresh tumor specimens, as well as the utility of FDG-PET in assessing response to immune checkpoint blockade.

Results:
From 1009 screened patients, 95 paired archival and fresh tumor samples were obtained. In these samples, the agreement of PD-L1 expression between fresh and archival tissue at the TC3 or IC3 cutoff was 88% when the same type of tissue procurement method was used (resection or biopsy), compared with 65% when different methods of procurement were used. To date, FDG-PET response has been centrally assessed in 71 of the 138 patients enrolled in FIR. Patients with metabolic response by EORTC criteria on 6-week scans had a higher ORR per RECIST v1.1 (72% [13/18]) than metabolic non-responders (ORR 4% [2/53]).

Conclusion:
There was a high agreement in TC3 or IC3 PD-L1 expression between archival and fresh tumor specimens. This work demonstrates that intra-patient heterogeneity in PD-L1 expression is low in metachronous tissues, indicating various types of tumor samples, including fresh or archival, can be reliably used to assess PD-L1 expression. In addition, FDG-PET has potential as an early on-treatment measure of response to atezolizumab. Further analyses will be presented. (NCT01846416)

Background:
Despite advances in treatment for NSCLC, the standard first-line treatment for metastatic disease remains platinum-based doublet chemotherapy with historical overall response rates (ORRs) of ≈30%. Preclinical data suggest that chemotherapy treatment can result in antigen release in the tumor microenvironment, potentially enhancing effects of cancer immunotherapy. Atezolizumab (MPDL3280A) is a human monoclonal antibody that targets the PD-L1/PD-1 immune checkpoint, while leaving the PD-L2/B7.1 interaction intact (which may reduce the risk of autoimmune lung toxicity). As atezolizumab has shown promising activity in advanced NSCLC, we investigated atezolizumab in combination with chemotherapy.

Methods:
A Phase Ib study was conducted to evaluate atezolizumab with chemotherapy in locally advanced or metastatic NSCLC patients who had not received chemotherapy for advanced disease. Pts received atezolizumab 15 mg/kg IV q3w with standard chemotherapy (carboplatin plus either paclitaxel [Arm C], pemetrexed [Arm D; nonsquamous] or weekly nab-paclitaxel [Arm E]) for 4-6 cycles followed by atezolizumab maintenance until progression. RECIST v1.1 was used to assess ORRs (unconfirmed) in pts dosed by Jun 29, 2014 (data cutoff: Sep 29, 2014). PD-L1 expression was centrally evaluated using the SP142 IHC antibody assay.

Results:
37 NSCLC pts were safety evaluable (8 in Arm C; 14 in Arm D; 15 in Arm E). Across these arms, 54% of pts were male, with a median age of 65 y (range, 40-82 y). 81% had non-squamous NSCLC, and 19% had squamous NSCLC. Median safety follow-up was 22.0 wks (range, 0.1-49.4 wks). Across arms, all-Grade AEs regardless of attribution included those commonly associated with chemotherapy, such as nausea (Arms C & D, 50%; Arm E, 73%), fatigue (Arm C, 38%; Arm D, 36%; Arm E, 73%) and constipation (Arm C, 25%; Arm D, 71%; Arm E, 27%). The most common Grade 3-4 atezolizumab-related AEs included anemia (Arms D & E, 7%), neutropenia (Arm C, 13%; Arm D, 7%) and thrombocytopenia (Arms D & E, 7%), with no pneumonitis or autoimmune renal toxicity observed. One potentially atezolizumab-related Grade 5 AE was observed in Arm D (candidemia after prolonged neutropenia). 30 pts were efficacy evaluable, and responses were observed in all arms regardless of PD-L1 expression (Table). Updated clinical data will be presented.

Table. RECIST v1.1 Responses in Patients with NSCLC

	Arm C: carboplatin + paclitaxel (n = 5)	Arm D: carboplatin + pemetrexed (n = 12)	Arm E: carboplatin + nab-paclitaxel (n = 13)	All Indicated Arms (n = 30)
ORR, %	60%	75%	62%	67%
95% CI, %	19%-92%	45%-93%	33%-83%	48%-82%
CR, n	0	0	2	2
PR, n	3	9	6	18

Conclusion:
Atezolizumab plus standard first-line chemotherapy was well tolerated in advanced NSCLC pts, with no unexpected toxicities. Clinical activity was promising and supportive of a potential synergy of atezolizumab with chemotherapy. Based on these results, several Phase III studies have been initiated.

Abstract not provided

Background:
Anlotinib is a multi-target RTK inhibitor, especially on VEGFR2/3, EGFR, c-Kit, PDGF, FDFR, c-MET, with highly selective inhibition effect. This phase II study was to investigate efficacy and safety of anlotinib in refractory NSCLC patients

Methods:
Patients ≥18 years with metastatic or recurrent advanced NSCLC and ECOG status of 0–1 were randomized 1:1 to receive Anlotinib or placebo (Anlotinib 12mg/day, po, day 1-14 each 3-week) until progression, unacceptable toxicity, withdrawal or death. Patients had received first and second line treatment for advanced NSCLC. Patients were stratified by gender, smoking status and age. We used RECIST (version 1.1) criteria to assess response and progression. Primary endpoint was PFS in ITT population; secondary endpoints included ORR, OS, biomarkers and safety.

Results:
From Aug. 2013 to May 2014, we enrolled 117 patients from 13 centers, including 60 patients to anlotinib arm and 57 patients to placebo. Baseline characteristics were similar in both treatment groups. PFS was prolonged with anlotinib 4.83 month vs placebo 1.23 months (HR 0.32, 95% CI 0.20–0.51, p<0.0001). ORR was improved with addition of anlotinib: 10% vs 0% with placebo (p<0.027).DCR was 83.3% with anlotinib vs 31.5% with placebo (p<0.0001). mOS was prolonged with Anlotinib 10.33 months vs placebo 6.3 months. (HR, 0.656; 95% CI, 0.411 to 1.048; P = 0.0776; Cutoff date: April 12, 2015. This mOS is an estimated data, OS events for both arms still not reach 75%). OS rate of >12 months is 22.8% in placebo arm and 38.3% in anlotinib arm. AEs occurred more frequently with anlotinib than placebo; the most common AEs of any grade were hypertension (53.33%), increased TSH (36.67%), hand foot syndrome (28.33%), increased TG (26.67%), increased TC (25%), cough (21.67%), diarrhea (21.67%), increased LDL (16.67%), hemoptysis (16.67%) oral mucositis (13.33%), and sore throat (13.33%). Grade III/IV treatment-related AEs increased 16.4% in anlotinib group (anlotinib: 21.6% , placebo: 5.3%, p=0.0140).

Conclusion:
This study confirms that anlotinib to third-line platinum-based chemotherapy appears to provide significant PFS benefits in Chinese patients with refractory advanced NSCLC compared with placebo. No serious safety concerns were reported in the study.

Background:
EGFR Exon20 mutations have been considered to be markers of acquired resistance to Tyrosine Kinase inhibitors. The association between Oral TKI response and Baseline Exon20 Mutations has not been addressed in many studies and remains to be evaluated.

Methods:
We conducted a retrospective audit of our prospectively maintained Lung cancer audit database in our institute in the year 2014.We reviewed data related to EGFR mutation testing by RQ-PCR using endpoint genotyping assay for EXON 20, 19, 21.We also reviewed data relating to baseline demographics,clinical profile, patient treatment and outcome measures in terms of response and survival.

Results:
We reviewed 807 sequentially tested lung cancer patients, who underwent molecular testing using RQ-PCR by endpoint genotyping assay. The overall mutation rate was 26.4% and 19 (2%) had baseline EGFR EXON20 mutation. The median age of patients was 56yrs [range: 29-81yrs], with 7 patients being females .There were 7 patients who gave past history of smoking. The most common site of metastasis was pleural effusion in 8,followed by Bone in 6,Brain in 5 and Liver metastasis in 2patients.Histology was adenocarcinoma in majority[16 patients].Among the types of EXON20 Mutations, 7 patients had S7681, 4 patients had INSGGT, 5patients had INS 9 and 4 patients had T790M mutation. All patients received chemotherapy as first line treatment. We have documented response assessment at 2months in 8 patients with progressive disease in 5[63%], stable disease in 2 and partial response in 1 patient. Second line therapy with Oral TKI was given to 9 patients, in whom we have documented response assessment in 6, all of whom had progressed.The median Overall survival of Exon-20 mutation positive patients was 5.5months. [Range of 3.8-7.2months], in comparison with other types of EGFR mutations which showed median Overall survival of 16.3months[range:12.7-19.4months

Conclusion:
EXON-20 Mutations in general proclaim grave prognosis, predicting limited benefit of chemotherapy and marked TKI resistance.

Background:
Lung cancers harboring common EGFR mutations respond to EGFR tyrosine kinase inhibitors (TKIs),whereas exon 20 insertions (Ins20) are known to be resistant to these drugs. However, little is known about the role of mutations in exon 18. Inspired by clinical observation that a patient with adenocarcinoma harboring exon 18 deletion (Del18: delE709_T710insD) responded to afatinib, this study aimed to establish a rational therapeutic strategy for lung cancers harboring exon 18 mutations.

Methods:
The mutational status of lung cancers registered in Aichi Cancer Center (ACC) database between 2001 and 2015 was reviewed. Three representative mutations in exon 18, Del18, E709K, and G719A, were introduced into Ba/F3, NIH3T3, and HEK293 cells using retroviral vector. The 90% inhibitory concentrations (IC90s) of first generation (1G) (gefitinib and erlotinib), second generation (2G) (afatinib, dacomitinib, and neratinib), and third generation (3G) TKIs (AZD9291 and CO1686) in these cells were determined and compared with the corresponding IC90s in cells expressing exon 19 deletion (Del 19) and with the trough concentration (C~trough~) at the recommended doses for each drug. Clinical data on the treatment response of tumors harboring exon 18 mutations were collected from the ACC and Catalogue of Somatic Mutations in Cancer (COSMIC) databases.

Results:
Among the 1355 EGFR mutations registered in the ACC database, Del19, L858R, and Ins20 were detected in 40%, 47%, and 4%, respectively. Of note, exon 18 mutations including G719X, E709X, and Del18 were present in 3.2% (n=43), accounting for 38% of the remaining. According to the COSMIC database, exon 18 mutations accounted for 4.1% (654/16,138) of all EGFR mutations present from exons 18-21. Mutations at codons 709 and 719 accounted for 84% of all exon 18 mutations. Ba/F3 cells expressing Del18, E709K, or G719A grew in the absence of interleukin 3, and NIH3T3 cells transfected with these mutations formed foci with marked pile-up, indicating that these mutations act as oncogenic drivers. IC90s of 1G and 3G TKIs in cells transfected with Del18, E709K and G719A were much higher than those in cells transfected with Del19 (by >50-, >25-, and >11-fold, respectively). In contrast, IC90 of afatinib in these three mutations ranged from only 2- to 6-fold greater than that in Del19 and was <1/40 of its C~trough~. Notably, cells transfected with exon 18 mutations exhibited higher sensitivity to neratinib (by 25-fold for E709K, by 5-fold for G719A, and by a comparable extent for Del 18) than those expressing Del19. Western blot analyses showed that these differential sensitivities corresponded to different degrees of suppression of EGFR phosphorylation in HEK293 cells. Furthermore, analyses of the ACC and COSMIC databases clearly indicated that patients with lung cancers harboring G719X exhibited higher response rate to afatinib or neratinib (~80%) than to 1G TKIs (35-56%).

Conclusion:
Our data indicated that lung cancers harboring exon 18 mutations, although rare, should not be overlooked in clinical practice and that these cases are best treated with afatinib or neratinib, although the currently available in vitro diagnostic kits do not detect all exon 18 mutations.

Abstract not provided

Background:
Previous series have shown that clinical benefit with pemetrexed-based systemic therapy can be durable in patients with ALK- and ROS1-rearranged lung cancers. The benefit of pemetrexed-based treatment in RET-rearranged lung cancers relative to other genomic subsets has not been explored.

Methods:
A retrospective review of records of patients treated at Memorial Sloan Kettering between 2007-2014 was conducted. Eligibility criteria: pathologically-confirmed advanced (stage IIIB/IV) non-small cell lung carcinoma, treatment with pemetrexed as monotherapy or in combination with other systemic agents, documented evidence of a rearrangement involving RET, ROS1, or ALK, or a KRAS mutation. Screening for these alterations was performed via break apart fluorescence in situ hybridization, multiplex mutation hotspot testing (Sequenom), or next-generation sequencing (MSK-IMPACT, Illumina HiSeq). Progression-free survival (PFS) and time to progression (TTP) were calculated using Kaplan-Meier estimates from the date of initiation of pemetrexed-containing therapy, and overall survival (OS) from diagnosis of metastatic disease. Overall response rate (ORR, RECIST v1.1), PFS, TTP, and OS were compared between RET-rearranged lung cancers and control groups (ALK- and ROS1-rearranged and KRAS-mutant lung cancers).

Results:
Data from 104 patients (RET-rearranged n=17, ROS1-rearranged n=10, ALK-rearranged n=36, KRAS-mutant n=41) were evaluated. As expected, median pack-year cigarette smoking history significantly differed between groups (p<0.001): RET 0 (0-48 range), ROS1 0 (0-12), ALK 0 (0-74), KRAS 38 (0-93). Features such as line of pemetrexed therapy (first vs other, p=0.1186), type of therapy (platinum combination, non-platinum combination, vs single-agent, p=0.1435), and need for dose reduction (p=0.9772) did not differ between groups. ORR, TTP, PFS, and OS in RET-rearranged lung cancers were not significantly different compared to ALK- and ROS1-rearranged lung cancers, and improved compared to KRAS-mutant lung cancers (Table 1). Table 1. Clinical Outcomes of Pemetrexed-Based Therapy

	RET	ROS1	ALK	KRAS	p-value
ORR	45%	78%	50%	26%	0.0242
Median TTP (months)	NR (20-NR)	32 (14-NR)	NR	7 (5-14)	<0.001
ALK vs ROS1 vs RET (p=0.90); RET vs KRAS(p=0.009)
Median PFS	20 (10-NR)	23 (14-NR)	24 (15-38)	6 (5-9)	<0.001
ALK vs ROS1 vs RET (p=0.94); RET vs KRAS(p=0.002)
Median OS	NR (24-NR)	NR (24- NR)	37 (30-63)	16 (13-29)	<0.001
ALK vs ROS1 vs RET (p=0.43); RET vs KRAS(p=0.002)

Conclusion:
Clinical benefit with pemetrexed-based therapy in RET-rearranged lung cancers can be durable and is comparable to ALK- and ROS1-rearranged lung cancers. Outcomes in RET-, ROS1-, and ALK-rearranged lung cancers were improved compared to KRAS-mutant lung cancers. Mechanisms responsible for pemetrexed sensitivity in these subsets should continue to be explored. Driver-independent factors such as smoking history may contribute to clinical benefit.

Background:
Crizotinib (crz) is registered only for the treatment of patients (pts) with ALK-translocated lung cancer. Crz is also a MET inhibitor. MET is amplified in several malignancies. Activity of crz in MET amplified (+) tumors was explored as part of the French National Cancer Institute (INCa) AcSé program, including both access to tumor molecular diagnosis and an exploratory multi-tumor 2-stage design phase II trial. We report here results in pts with MET + NSCLC.

Methods:
MET analysis on formalin-fixed, paraffin-embedded tumor samples was proposed in 170 investigating centers and performed in 28 regional INCa molecular genetic centers. MET+ was explored by FISH in tumor samples showing an IHC score of ≥2+. Pts with a tumor showing > 6 MET copies, whatever the MET/CEN7 ratio, were eligible, providing they were not eligible for any other academic or industry trial evaluating another MET inhibitor. Study treatment consisted in crz 250 mg BID. The objective response rate (ORR) and disease control rate (DCR) were assessed every 8 weeks, using RECIST v1.1.

Results:
From Aug. 5, 2013 to Mar. 1, 2015, 25 pts with MET+ NSCLC were enrolled and received crz. Median age was 59 years (range 30–92). Forty-four percent were females, 92% had tumors of non-squamous histology, and 96% presented with metastatic disease at study entry. Median number of prior treatments was 2 (range 0 – 11). Eight pts were still on treatment at the cut-off date, 17 have stopped crz (15 progressive diseases (PD), 1 adverse event (AE), 1 patient’s choice). Among the 18 pts evaluable for response after 8 weeks, we observed 7 partial responses, 6 stable diseases and 5 PD, leading to an ORR of 39% [95% CI:17-64], and a DCR of72% [47-90]. DCR at 6 months was 22% (4 pts out of the 18 evaluable pts). Crz was well tolerated with only 5 grade ≥3 (2 AE + 3 SAEs) and 3 grade 1-2 SAEs. Most common AEs, mainly grade 1 or 2, were nausea (60% of pts), visual disorders (52%), anemia (52%), elevated transaminases (48%) and vomiting (40%).

Conclusion:
Nationwide biomarker-driven access to crz for pts with MET+ malignancy is feasible. Crz was well tolerated and showed responses in pretreated MET+ lung cancers. Survival data and duration of response will be presented.

Background:
Mutations in the MET exon 14 RNA splice acceptor and donor sites, which lead to exon skipping, deletion of the juxtamembrane domain, and loss of Cbl E3-ligase binding to the resultant aberrant MET protein, were previously reported to be oncogenic in preclinical models (Kong-Beltran, Cancer Res 2006). These mutations occur in 4% of lung adenocarcinomas but have not been clinically assessed (TCGA 2014). We now report responses to the MET inhibitors crizotinib and cabozantinib in patients with stage IV lung adenocarcinomas harboring mutations leading to MET exon 14 skipping.

Methods:
Patients with stage IV lung adenocarcinomas harboring MET exon 14 splice site mutations (N=6) or a mutation deleting Y1003 in exon 14 (N=1) were identified through a clinical assay based on hybrid capture/next-generation sequencing of 341 oncogenes and tumor suppressors (MSK-IMPACT). MET IHC was performed on archival FFPE tissue. RNA skipping was confirmed by NanoString. Radiographic response to MET inhibition was assessed using RECIST 1.1 and PERCIST criteria.

Results:
Clinicopathologic data for those treated (N=4) are in the table below:

ID	Age	Sex	Smoking status (pack years)	MET exon 14 variant	MET therapy	Response	MET IHC (H-score)
1	65	M	C (20)	MET p.V1001_F1007del (c.3001_3021delGTAGACTACCGAGCTACTTTT)	crizotinib (3rd line)	PR (-31%)	NA
2	80	M	F (20)	MET c.3024_3028delAGAAGGTATATT	crizotinib (3rd line)	PR (-30%)	300
3	90	F	N	MET c.3028G>C	crizotinib (3rd line)	PR (-47%)	NA
4	80	F	N	MET c.3028G>C	cabozantinib (3rd line)	SD (0%), CR (PERCIST)	300

To date, 3 patients have been treated with off-label crizotinib and 1 with cabozantinib (NCT01639508). Three of four patients (75%) developed a PR to treatment. The remaining patient had SD by RECIST, with PET imaging demonstrating a complete PERCIST response to treatment.

Conclusion:
MET exon 14 skipping is a novel oncogenic target that predicts for response to MET inhibitors. This appears to be a substantially better predictor of response than either protein expression or gene amplification. Patients with these splice site mutations should be treated on a clinical trial of a MET inhibitor. For those without access to a trial, use of off-label crizotinib should be considered.

Abstract not provided

Background:
From our randomized controlled phase III trial of adjuvant chemo‑immunotherapy in lung cancer patients, the preliminary results indicated significant advantage in immunotherapy arm combined with chemotherapy. We report here the final analysis and long term results with 42.8 months of median follow up time.

Methods:
Between April 2007 and July 2012, 103 postsurgical non-small cell lung cancer patients were randomly assigned to receive either chemo-immunotherapy (group A) or chemotherapy (group B). The immunotherapy consisted of the adoptive transfer of autologous activated killer T cells and dendritic cells obtained from the lung cancer patients’ own regional lymph nodes.

Results:
The 2-year overall survival rates in groups A and B were 96.0 and 64.7 %, and the 5-year rates were 74.6 and 40.9 %, respectively, and the results confirmed the statistically significant difference analyzed 2 years previously. The hazard ratio (HR) was 0.321 (95% Confidence Interval 0.164~0.631). The 2- and 5-year recurrence-free survival rates were 68.0, 41.2 and 57.2, 29.2 % in groups A and B, respectively. Those differences were also statistically significant (log-rank test p = 0.0020). The HR was 0.435 (p = 0.0027) in favor of group A. Subgroup analysis between treatment groups using cox models indicated male (HR: 0.351, 95%CI: 0.171~0.721), Adenocarcinoma (HR: 0.279, 95%CI: 0.116~0.669), stage III (HR: 0.228, 95%CI: 0.092~0.564) and those who did not received preoperative chemotherapy had lower hazard ratio compared to other groups. Immunological analysis of cell surface markers in regional lymph-nodes of immunotherapy patients indicated the ratios of CD8 vs CD4 (CD8/4) are elevated in survivors.

Conclusion:
The final results of the statistical and immunological analysis of the study confirmed the efficacy of immunotherapy in adjuvant treatment of lung cancer patients. The study indicated the advantages and limitations of cell mediated immunotherapy and a large-scale multi-institutional RCT is inevitable for the clinical application of the study.

Background:
Postoperative adjuvant chemotherapy is extensively received due to its extension of the time to recurrence and enhancement of survival rate in NSCLC. However, it has reached the plateau presently, the beneficial cases are few, and drug-resistance and over-treatment phenomena are in most of patients, hence it is necessary to seek new postoperative adjuvant chemotherapy to improve the survival rate. Angiogenesis is one premise of occurrence, development and metastasize of malignant tumors, but VEGF is one of the most important tumors in the process of neovascularization. Under normal conditions, VEGF is hardly expressed in a lot of normal tissues in vivo, while highly expressed in the tumors. Endostatin can significantly intervene the angiogenesis-promoting effect to block the nutritional supply for tumors and inhibit tumor proliferation or metastasis. We compare the curative effect of endostatin plus adjuvant chemotherapy and adjuvant chemotherapy alone in the treatment of patients with completely resected NSCLC at stage IB-IIIA.

Methods:
This is an open, multicenter, randomized (1:1) study, stratified by gender, stage and histology. Completely resected pts (stage IB to IIIA) were randomized to receive adjuvant NP plus Endostatin (Vinorelbine 25mg/m2 on d1 and d8 plus Cisplatin 75 mg/m2 on d1, and iv plus endostatin 7.5mg/m2 per day iv for consecutive 14 days, every 21 days as one cycle, 4 cycles in total) or NP regimen alone. The primary endpoint was disease-free survival (DFS). Secondary endpoints included tumor response rate, overall survival and safety.

Results:
250 pts (1:1) were included from 07/2007 to 06/2009. Two arms were well-balanced with regard to age, gender, histology, staging, and resection type. The follow-up time was 60 months. The two groups had no significant difference in the incidence of toxicity reaction. Endostatin plus NP can prolong the DFS of patients with completely resectable NSCLC at stage IIIA with high security, but with no statistical difference (19.33±3.73 m vs 17.10±9.68 m). Cases with high expression of VEGF showed a better DFS than cases with low expression in endostatin plus NP group (48.45±3.52m vs 40.18±4.54m, P < 0.05). The level of peripheral circulating endothelial progenitor cells (EPCs) in NSCLC patients was significantly higher than that in healthy volunteers. EPCs level was associated with NSCLC stage. The EPCs levels after treatment significantly decreased than that before treatment (P=0.014) in beneficiaries of NP or NP plus with endostatin. The time to progression (TTP) was longer in patients with lower levels of EPCs (<0.35%) before chemotherapy or endostatin treatment (P<0.001). However, no statistically significant difference in OS was noticed between the two arms (P = 0.962). The survival rate of endostatin plus NP group was higher for patients in stage IIIA NSCLC, but the differences did not reach statistical significance (MST 41.267 months vs 39.533 months, P = 0.760).

Conclusion:
Vascular targeted therapy could prolong the DFS of patients with complete resectable NSCLC in stage IIIA, but did not show benefits in OS for stage IB−IIIA. We shall develop new strategies to identify the patient subgroups that will be benefited or harmed by vascular targeted therapy.

Background:
In resected early stage (II-IIIA) non-small cell lung cancer (NSCLC) adjuvant chemotherapy improves overall survival but the benefit is limited and pharmacogenomics tailored treatment is a potential way to further improve outcome. A phase III multicenter randomized trial comparing adjuvant pharmacogenomics-driven chemotherapy, based on thymidylate synthase (TS) and excision-repair cross-complementing-1 (ERCC1) gene expression versus standard adjuvant chemotherapy in completely resected Stage II-IIIA NSCLC recently completed patients’ (pts) enrolment (EudraCT #: 2008-001764-36).

Methods:
The mRNA ERCC1 and TS expression by qRT-PCR was centrally assessed on paraffin-embedded, post-surgical tumor specimens in all registered pts. Immunohistochemistry (IHC) straining for ERCC1 (using 2 monoclonal antibodies, 8F1 and 4F9) and TS protein expression was also performed. Randomization was stratified by stage and smoking status. Trial was emended on February 2011 to include the 7th staging system. The primary end point of the study is overall survival; secondary end points include recurrence-free survival, therapeutic compliance, toxicity profile and comparative evaluation of ERCC1 and TS mRNA versus protein expression. Study design was already reported [Novello S et al, JTO 2013; 8 (Suppl 2) P3.12-023].

Results:
Enrolment was concluded in August 2014 and at that time all gene expression data were available. Recruitment and gene expression results were completed in August 2014. 386 pts were included in the control arm, 375 in the tailored arm and 41 were excluded as screening failures (14) or are not yet fully evaluable (27). Statistical correlations to compare treatments received, toxicity profiles and pts’ survival data in the tailored and control groups are ongoing. Further data analyses will include the correlation between biomarker ERCC1/TS mRNA and protein expression levels, as well as compare ERCC1-IHC scores with the 2 ERCC1 antibodies. The distribution of some baseline characteristics depending on the molecular profile is shown in Table 1. Figure 1



Conclusion:
This trial will provide robust evidence if a tailored therapeutic strategy based on selected gene expression profile may contribute to improve efficacy and to ameliorate toxicity of adjuvant chemotherapy in completely resected early stage NSCLC.

Abstract not provided

Background:
Postop platinum-based CT improves outcomes in completely resected NSCLC with nodal involvement (St II-IIIA) but compliance and outcomes remain limited. Analysis of expression of genes involved in DNA repair could be used to individualize optimal CT. BRCA1 is primarily involved in the repair of double strand DNA breaks and functions as a differential regulator of response to cisplatin (Cis) and antimicrotubule agents. BRCA1 defficiency can enhance Cis resistance. Loss of BRCA1 function is associated to sensitivity to DNA-damaging CT and may also be associated with resistance to spindle poisons

Methods:
Randomized phase III multicenter trial. After surgery patients (p) with St II and III NCSLC were random 1:3 to control arm (3 cycles Cis-Docetaxel) or to experimental arm with treatment assigned according BRCA1 expression levels (low levels: Cis-Gemcitabine; intermediate levels: Cis-Doc; high levels: Docetaxel alone). Stratifification factors: N1 vs N2; age < or > 65 y; non-Squamous vs Squamous (Sq) histology; lobectomy vs pneumonectomy). Planned PORT in N2. Primary end-point OS. Secondary end-points DFS, toxicity profile (CTCAE v 3.0) /compliance, recurrence pattern. Statistical hypothesis: increase 20% 5y survival rate control group (45%)

Results:
From June/2007 to May/2013, a total of 591 p were screened and 500 of them were randomized in the study, 108 in control arm, 392 in experimental arm. In experimental arm 110 p received Cis-Gem, 127 Cis-Doc and 110 Doc alone. There were no significant differences between arm for known prognostic factors: Median age 64 y; 79% males, 21% females; 43% Sq, 49% Adenoca, 8% others; 57% former smokers, 32% current smokers, 11% never smokers; pneumonectomy 26%; N1 58%, N2 48%. Median tumor size 4.4 cm (0.8-15.5 cm). Median mRNA BRCA1 levels 15.78 (0.73-132). Mean BRCA1 levels 6.95 in Adenoca vs 20.29 in Sq (p<0.001). P with Sq histology showed a longer DFS (HR 0.73; p=0.05) but without differences in OR (HR 1) Median follow-up 28 months (0-79 m), with a cut-off of March 15[th] 2015, median survival has not reached both arms and no significant differences have been seen for OS with hazard ratio (HR) 0.866 (p=0.45) or DFS with HR 1. In experimental group HR for OS was 0.842 (NS) comparing low with high-BRCA1 levels. In p with high-BRCA1 levels control treatment (Cis-Doc) was superior to experimental (Doc) with HR 1.24 (NS).In non-Sq histology experimental treatment was superior to control with HR 0.75. For p receiving all planned treatment HR is 0.63 with p = 0.043 compared with p not able to complete treatment.

Conclusion:
Overall survival data are still immature because median survival is not reached with a median f-u 28 m for this N+ population. At this time analysis BRCA1 based adjuvant CT does not improve overall OS. In p with high BRCA1 levels Doc alone is inferior to Cis-Doc. BRCA-1 levels are higher in Sq and in non-Sq histology a trend to better survival in experimental arm was found. Full dose of planned treatment confers a survival advantage, however, longer follow-up is still warranted.

Background:
Non-small cell carcinoma is the most common type of lung cancer. A few recent prospective trials have shown that the addition of adjuvant chemotherapy after operable stage II non-small cell carcinoma patients is associated with an improved survival[1,2]. Adjuvant chemotherapy is effective but underutilized. Our aim was to analyze the practice patterns for adjuvant chemotherapy use in stage II non-small cell lung carcinoma using the National Cancer Database (NCDB).

Methods:
We selected a historical cohort of patients diagnosed with stage II non-small cell carcinoma between 2000 and 2012. This cohort is selected from the National Cancer Database (NCDB). NCDB is a national oncology outcomes database that includes 70% of new cancer diagnoses from more than 1,500 Commission on Cancer accredited programs in the United States and Puerto Rico. We studied this cohort to find out the difference in patterns of adjuvant chemotherapy use among stage II non-small cell carcinoma patients based on demographic and insurance characteristics. Two-tailed chi-square test was used as the test of significance with a p-value < 0.05 being considered significant. All values are given in percentages.

Results:
The total number of patients diagnosed with stage II lung cancer between the years 2000 to 2012 was analyzed (n=112430). We observed an increase in the percentage of patients receiving adjuvant chemotherapy from 9% to 18% from the year 2003 to 2004. The factors associated with increased adjuvant chemotherapy use were private insurance, ages 30 to 69, White/Hispanic race, higher education, higher income groups and female gender (p<0.0001)(Table 1). Table 1. Adjuvant Chemotherapy use in stage II Non-Small cell lung cancer.

VARIABLES INCLUDED	PERCENTAGE OF PATIENTS RECEIVING ADJUVANT CHEMOTHERAPY
Diagnosis year
2000-2003	6
2003-2012	23
Age
<30	7
30-49	22
50-69	25
69-89	9
Insurance status
Private/managed	26
Medicaid	19
Medicare	15
Uninsured	17
Sex
Male	17
Female	19
Annual Household Income (USD: 2012 census)
<36000	15
36000-43999	17
44000-52999	18
53000-68999	19
>69000	21
Educational Status (% Patients without HS degree)
>23%	15
15-22.9%	17
11- 14.9%	18
6-10.9%	19
<6%	21
Race
White	18
Black	17
Hispanic	19
Charlson comorbidity score
None	21
One	23
>= 2	18

Conclusion:
This cohort illustrates the increase in adjuvant chemotherapy use from 2000 to 2012 with significant increase during the year of 2004. Access to adjuvant chemotherapy is dependent on various demographic factors. The treatment and outcomes of non-small cell carcinoma is dependent on the type of treatment used, which itself is affected by the population demographics and health system factors. These variables should be studied in detail to find out the cause for the underutilization of adjuvant chemotherapy despite the evidence of survival benefit in patients with stage II non-small cell carcinoma of lung.

Background:
Adjuvant cisplatinum-based chemotherapy is recommended in patients with stages IB (≥ 4 cm), IIA, IIB, and IIIA of non small-cell lung cancer (NSCLC) after radical resection. Vinorelbine with cisplatin are preferable drugs in this indication, but the side effects of this treatment were not negligible in big adjuvant trials. Carboplatin with vinorelbine given intravenously switched to orally were applied in a multicentre prospective study SWITCH I to give better comfort, higher tolerability and comparable effectivenes as standard adjuvant chemotherapy. The recruitment period started in January 12[th], 2005 and lasted till September 5[th], 2008.

Methods:
Consecutive chemo-naive patients were recruited after complete resection of NSCLC stages IB, IIA, IIB and IIIA. Chemotherapy was applied from 2 to 6 weeks after complete resection. Four cycles of 21 days regimens were planned, Patients received carboplatin AUC 5 on the day 1,vinorelbine 25 mg/m[2] intravenously on the day 1 switched to 60 mg/m[2] orally on the day 8. Follow-up visits with physical evaluation, chest CT and laboratory tests have been realized every 3 months for 2 years and then every 6 months. Tolerability, side effects, relative dose intensity and survival were evaluated.

Results:
Seventy four patients (pts) were recruited to the SWITCH I study: 53 men and 21 women, 45 smokers, 23 ex- smokers and 6 non-smokers. Median age was 64 y (48-75 y). Tumor was squamous in 46, adenocarcinoma in 22, giant cell in 4 and NOS in 2 pts. Stage of the tumor was IB in19, IIA in 8, IIB in 22 and IIIA in 25. Mean number of applied cycles was 3.77 four planned cycles finished 82,4% patients. The most frequent hematological toxicities grade 3/4 were neutropenia (25.7 %), leukopenia (16.2 %), anemia (8.1 %) and trombocytopenia (2.7 %). Non-hematological toxicities were alopecia (12.2 %), nausea (4.1%), nefrotoxicity (1.4%) and diarrhoea (1,4%). Median of follow up was 4.73 y. Median of disease specific survival was 7.63 y (95% CI: 4.57 to NR), median of overall survival (MOS) was 5.9 y (95% CI, 3.7 to, NR) and median of disease free survival (DFS) 4.43 y . Three-year survival of 70.3% and five-year survival of 56,2% were reached.

Conclusion:
Adjuvant chemotherapy with carboplatinum and vinorelbine given intravenously on the day 1 and orally on the day 8 in 21 day regimen appears to be a comfortable and tolerable therapy in radically resected NSCLC. It provides higher dose intensity and more of acomplished treatments compared to big adjuvant trials and LACE meta-analysis, in which these parametres varied between 50 % to 76 % only. Survival results are comparable to LACE (3-year survival 70,3% vs 64.3%), 5-year survival 56,2% vs 55.1%) and MOS 5.9 vs 5.15 y). Supported by Grant Grant IGA MZ ČR NT/13569 of the Czech Ministry of Health.

Abstract not provided

Background:
Identifying surgical non-small cell lung cancer (NSCLC) patients with poor prognosis remains a priority in clinical oncology given their high 5-year mortality. [18]F-FDG PET/CT can add important biological information of glucose metabolism to conventional imaging modality. Pretreatment maximal standard uptake value (SUV~max~), metabolic tumor volume (MTV) and total lesion glycolysis (TLG) may predict prognosis in NSCLC patients. Thus, we performed this meta-analysis to explore the prognostic value of SUV~max~, MTV and TLG on disease-free survival (DFS) and overall survival (OS) in surgical NSCLC patients.

Methods:
A systematic search of MEDLINE, EMBASE and Cochrane Library was performed. Inclusion criteria were: pathologically confirmed NSCLC; [18]F-FDG PET used as an initial imaging tool before treatments; patients underwent curative surgery without neoadjuvant therapy; prospective or retrospective studies reported; complete survival data. Three investigators reviewed and scored each article independently on four dimensions: the scientific design, the generalizability of the results, the analysis of the study data and the PET reports. DFS and OS were considered as the outcome. The correlation of SUV~max~, MTV or TLG with survival was measured by hazard ratio (HR). Sub-group analyses were performed according to the histological subtype and pathological stage. The inter-study heterogeneity was evaluated with the Cochrane’s Q test as well as I[2]. The possibility of publication bias was assessed by visual inspection of a funnel plot and Begg’s test. “Trim and fill” procedure that considers the possibility of hypothetical “missing” studies that might exist was performed to further assess the possible effect of publication bias.

Results:
Thirty studies with 5011 patients were included for the meta-analysis. The mean quality score was 77.5%, ranging from 70.0% to 87.5%. Only one study was prospectively designed. SUV~max~ was measured in 28 studies, all of which were normalized by body weight. MTV was measured in 6 studies and TLG was measured in 5 studies. Adjusted HRs could be determined for 20 studies. For DFS, the combined HRs were 2.61 (95%CI 2.20-3.11, unadjusted) and 3.04 (95%CI 2.24-4.11, adjusted) for SUV~max~, 2.27 (95%CI 1.77-2.90, unadjusted) and 2.49 (95%CI 1.23-5.04, adjusted) for MTV, 2.46 (95%CI 1.91-3.17, unadjusted) and 2.97 (95%CI 1.68-5.28, adjusted) for TLG, respectively. For OS, the pooled HRs were 2.22 (95%CI 1.90–2.61, unadjusted) and 1.61 (95%CI 1.32-1.96, adjusted) for SUV~max~, 3.40 (95%CI 2.27-5.09, unadjusted) and 1.91 (95%CI 1.13-3.22, adjusted) for MTV, and 3.85 (95%CI 2.52-5.86, unadjusted) and 1.76 (95%CI 0.96-3.21, adjusted) for TLG, respectively. When the publication bias was detected by Begg’s test, “trim and fill” procedure was performed and similar HRs were obtained. The predictive role of SUV~max~, MTV and TLG remained similar in the sub-group analysis.

Conclusion:
High values of SUV~max~, MTV and TLG predicted a higher risk of disease recurrence or death in patients with surgical NSCLC. It is suggested that FDG PET/CT be used to select patients at high risk of disease recurrence or death and may benefit from more aggressive treatments. Further individual patient data should be analyzed to determine the optimal threshold value.

Background:
The main objective of the ongoing phase III Lung Adjuvant Radiotherapy Trial (Lung ART) is to study the impact of post-operative conformal radiotherapy (PORT) on disease-free survival (DFS) in a population of patients with completely resected pathologically proven N2 non-small cell lung cancer (NSCLC), with or without induction or adjuvant chemotherapy. Quality of surgical resection and extent of lymph node dissection are critically important in the interpretation of results.

Methods:
A surgical advisory committee composed of 4 international expert thoracic surgeons meets regularly in order to establish the quality of resection, taking into consideration the International Association for the Study of Lung Cancer and European Society of Thoracic Surgeons published guidelines. The committee reviews anonymized surgical and pathological reports, and establishes whether tumor resection can be considered complete (no residual tumor and adequate lymph node assessment), uncertain (highest mediastinal nodal station involved, incomplete nodal exploration, involved N2 removed in fragments) or incomplete (presence of residual tumor). Nodal exploration is evaluated according to recommendations and classified as sampling, selective dissection or extensive dissection.

Results:
As of April 15th 2015, 298 patients have been included in the Lung ART trial and 116 patients’ reports have been analyzed by the surgical advisory committee. The basic characteristics are specified in the following table:

	Total n=116
	Frequency	Percent
Induction chemotherapy
no	89	77%
yes	27	23%
Type of surgery
for right-side tumors	70	60%
lobectomy	49	70%
bilobectomy	9	13%
pneumonectomy	5	7%
other	7	10%
for left-side tumors	46	40%
lobectomy	34	74%
pneumonectomy	10	22%
other	2	4%
Tumor Size (mm)
Median size (range)	35 [0*-105]
Number of mediastinal lymph nodes examined
Median number (range)	10 [1-37]
Number of mediastinal lymph nodes involved
Median number (range)	1[0*-15]
Number of mediastinal nodal stations involved
0*	5	4%
1	79	68%
2	20	17%
>2	12	11%
* patients with downstaging after induction chemotherapy

Nodal dissection was performed according to lobar location specific recommendations in most patients: for instance, station 7 was explored in 91% patients and right inferior paratracheal station 4R in 93% of right side tumours. Nodal dissection was performed according to recommendations in 71% pts; 16% patients had sampling, 22% a selective dissection and 62% a systematic dissection. Resection was considered complete (R0) in 43%, uncertain in 42%, microscopically incomplete (R1) in 14% and macroscopically incomplete (R2) in 1 patient. The most frequent reason for “uncertain resection” was involvement of the highest mediastinal lymph node.

Conclusion:
Most adjuvant trials have included completely resected patients, without monitoring of the quality of nodal exploration and resection. This analysis outlines the importance of an external committee evaluating the quality of resection in stage IIIA-N2 NSCLC, and the findings of this audit will be useful in the interpretation of the results of the trial.

Background:
We sought to show that TransCervical Mediastinal and hilar Lymphadenectomy (TCML), using standard mediastinoscopy equipment, reliably accesses both mediastinal and hilar lymph node stations, provides accurate pre-treatment cancer staging, and facilitates Minimally-Invasive Cancer Resection (MICR) via removal of nodes traditionally dissected during definitive cancer resection.

Methods:
We reviewed our prospective databases for patients who had TCML - complete removal of lymph node tissue (not sampling) using a standard mediastinoscope +/- video-assistance. Pathological findings from TCML and definitive cancer resections were correlated. TCML's impact on cancer resection was assessed.

Results:
From 2004-2011, 372 patients, mean age 68.4 (28-93) years, 239 (64%) males and 133 (36%) females, had TCML. Cancer diagnoses included lung 306 (82.3%) and other 37 (17.8%). Median surgical time was 93 mins (supervised residents). There were no intra-operative complications or deaths and only 9 (2.4%) postoperative complications. The mean number of individual lymph nodes removed was 31.2/patient (range 7-78). The total and mean numbers of nodal stations removed/patient are shown the Figure (mean = 7), and specific lymph node stations removed are shown in the Table. Although hilar nodes were removed in <43%, in specific circumstances, such as RUL tumors with neg. mediastinal nodes, hilar nodes were removed in 20/29 (69%) of cases. MICR immediately after TCML usually was technically easier and faster because of the hilar dissection When resections were delayed 3-7 days, TCML was less technically beneficial because of inflammation and scarring, and delays >1 week resulted in significant detrimental effects on resection. Complete removal of all nodal tissue was confirmed during definitive cancer resection in >98% thereby providing accurate pre-resection cancer staging. Figure 1

Data represents the percentage of the 372 TCML cases with the specified lymph node stations surgically addressed

	Right (%)	Left (%)	Midline (%)
Level 1	4.3	0.54
Level 2	78.23	38.17
Level 4	97.58	94.62
Level 10	43.01	24.19
Level 11	28.49	9.41
Level 12 (upper lobe)	10.75	3.23
Level 12 (lower lobe)	0.27	0.54
Level 12 (middle lobe)	1.35	N/A
Level 8	2.69	3.49
Level 9	0.00	0.27
Level 5		2.51
Level 6		4.03
Level 3 (anterior)			5.38
Level 3 (posterior)			1.62
Level 7			95.43

Conclusion:
TCML is safe, accurate and feasible without elaborate instrumentation. TCML is capable of reliably accessing not only mediastinal but also hilar nodal stations and facilitates MICR if performed within 7 days of TCML.

Abstract not provided

Background:
Significant controversy remains regarding the care of patients (pts) with clinical stage IIIA NSCLC. While multi-modality therapy is an acceptable strategy in selected pts, the optimal approach is not firmly established. We analyzed outcomes and predictors associated with trimodality therapy (TT) in the National Cancer Database (NCDB), an oncology outcomes database administered by the American College of Surgeons and the American Cancer Society.

Methods:
The NCDB was queried from 2003-2011 for NSCLC pts diagnosed with stage IIIA-N2 disease and treated with chemotherapy and radiation (CRT). Data was extracted on patient demographics, tumor pathology, treatments and outcomes. Three cohorts of pts were studied - CRT only/no surgery (NS), CRT + lobectomy (L) and CRT + pneumonectomy(P). The univariate and multivariable analyses (MV) were conducted using Cox proportional hazards model and log rank tests. All analyses were performed using SAS Version 9.3.

Results:
A total of 29,584 pts were included in this analysis: NS-91.7%, L-7%, and P-1.5%. Pt characteristics: median age 66 years (yrs); males 56%; whites 86%; academic centers 27%; metro locations 78%; government insured 63%; Charlson/Deyo comorbidity score 0 in 66%. Pts < 60 yrs were more likely to receive TT- L (47%), P (60%) vs. NS (29%); p<0.001. Pts in academic centers were more likely to get TT than NS (42% vs. 25%). On MV analysis, L and P had significantly better survival vs. NS: HR 0.43 (0.38-0.48) and HR 0.57 (0.46-0.71) respectively; p <0.001. The median survival of L, P and NS were 44.5 m vs. 25.6 m vs. 15.7 m (p<0.001) and 5- year survival rates (SR) were 44% vs. 33% vs. 14% respectively. 30-day mortality was higher in P vs. L [7% vs. 2.6%; OR 0.26(0.16-0.45); p<0.001]. Pts with <2 lymph nodes (LN) had better survival than pts with >2 LNs in L (50% vs. 37%; 60m vs. 38.8m) but worse in NS (13.8% vs.16.4%; 15.3m vs.18.5m). On MV analysis of LNs, L had better survival than NS: HR 0.4 (0.35-0.46) in <2 LN pts and HR 0.56 (0.46-0.69) in ≥2 LN pts; p<0.001. In pts with <2 LN, L had better survival than P (60m vs. 25.5m; p<0.0001). L and P had better SR than NS in all ages: 48% vs.37% vs. 19% in ≤60 yrs; 42% vs. 30% vs.14% in 61-70 yrs, 36% vs.19% vs. 10% in >70 yrs.

Conclusion:
TT was utilized in less than 10% of pts with stage IIIA-N2 disease, suggesting high degree of pt selection. In this selected group, TT was associated with favorable outcomes relative to CRT alone.

Background:
Video-assisted thoracoscopic lobectomy(VATS) is preferred over thoracotomy for the treatment of early stage non-small cell lung cancer (NSCLC). However, little evidenceindicated its perioperative and oncologic outcomes for advanced-stage NSCLC and the result of VATS surgery may be overestimated since the majority of patients were stage I patients in previous studies. Therefore, we evaluate whether VATS lobectomy for locally advanced NSCLC could be performed safely and with acceptable short- and long-term outcomes when compared with standard thoracotomy on a well-balanced population from a multi-institutional database.

Methods:
Tumors that are greater than 5 cm in diameter, T3 or T4 tumors, tumors after neo-adjuvant treatment, and/or tumors with lymph node metastasis are defined to be locally advanced. By using a multi-institutional prospective database of high level comprehensive cancer hospitals, we analyzed locally advanced NSCLC patients who underwent lobectomy. VATS lobectomies were all performed by an improved technique, which had achieved proficiency that has been published previously. Using propensity-matched analysis based on preoperative variables, perioperative outcomes, oncologic efficacy and long-term survival were compared between VATS lobectomy and thoracotomy.

Results:
Matching based on propensity scores produced 125 patients in each group. Patient and tumor characteristics were similar. Conversion rate from VATS to thoracotomy is 9.6%. There were no intraoperative deaths and 1 perioperative death in each group. Postoperative outcomes like median operative time, blood loss and tube duration were similar between VATS and thoracotomy, Hospital length of stay was shorter after VATS than thoracotomy(10.4d vs 11.4d, p<0.01). VATS group had significant lower level of postoperative pain than thoracotomy group (p<0.01). The overall incidence of postoperative complications was 28.8% (36/125) and 36.0% (45/125)in the VATS group and in the thoracotomy group, respectively(p = 0.14).Similar number of lymph nodes (16.2vs 14.8, p= 0.148)and nodal stations (5.72 vs 5.66, p= 0.781) were removed by VATS and thoracotomy. Similar proportion of patients accepted postoperative chemotherapy (73.6% vs 72.0%, p= 0.776) , and completed similar cycles of postoperative chemotherapy (2.47 vs.2.35, p = 0.602) in the two groups. Median follow-up was 36.6 months. There were no significant differences in locoregional and distant recurrence patterns between the two groups. Disease-free survival(DFS) at 3-years were 50.1% and 47.3%, 5- years were 40.0% and 37.0% in the VATS and thoracotomy groups, respectively (p=0.878). Overall survival(OS) at 3-years were 75.0% and 68.9%, 5-years were 42.2% and 43.1% in the VATS and thoracotomy groups, respectively (p =0.551). Multivariate Cox regression analyses of DFS and OS confirmed the noninferiority of VATS, and showed that significant predictors of worse DFS and OS were advanced pathologic stage (HR,2.235; 95% CI,1.564 to 3.193; p<0.001), and without postoperative chemotherapy (HR,1.594; 95% CI,1.095 to 2.321; p=0.015).

Conclusion:
VATS lobectomy for locally advanced stage NSCLC can be performed safely, with shorter length of hospital stay, lower level of pain and showed similar long-term survivals compared to thoracotomy. With continued experience and optimized technique, VATS lobectomy can be performed in majority of cases without compromising the perioperative outcomes and oncologic efficacy. This work was supported by a funding named‘Beijing Municipal Science and Technology Project (D141100000214004)

Background:
Individual academic societies have published different recommendations about definitions and requirement of nodal assessment. It's generally agreed that radical mediastinal lymphadenectomy will provide accurate information for pathological staging and guiding adjuvant therapy. However it is not clearly established whether mediastinal lymphadenectomy compliant with international criteria will improve the oncological outcomes of clinical early-stage lung cancer. This retrospective study was aimed to compare the long-term survival between the cases treated with lymphadenectomy fulfilling the NCCN criteria and other cases not met the criteria in clinical early-stage lung cancer patients.

Methods:
During the investigation period, 712 consecutive cases of clinical N0/1 entered the analysis, confirming as 152 cases of pN2 (pathological N2) and 560 of pN0-1 (pathological N0-1) disease after surgery. Group A was defined as the cases fulfilling the National Comprehensive Cancer Network (NCCN) lymphadenectomy criteria (≥three stations of N2 nodes dissection) and Group B was those who did not meet the criteria. Two groups were stratified by pN status and the outcomes were analyzed and multivariate Cox regression was performed to determine prognostic factors.

Results:
5-year Overall survival (OS) and 5-year disease-free survival (DFS) were significantly different between two groups at cN0/1-pN2 status (5-year OS rates, 50±5% vs. 25±9%, p=0.006; 5-year DFS rates, 31.0±4% vs. 13±7%, p=0.014), but not at pN0-1 status (Figure 1). T staging and lymphadenectomy fulfilling NCCN criteria were prognostic factors in cN0/1-pN2 group by multivariate regression analysis. Furthermore, the cases treated with ≥ 4 stations of mediastinal lymph nodes dissection could not achieve better survival benefit compared to those harvesting 3 stations of N2 node in cN0/1-pN2 group (the 5-year OS rates, 46±6% vs. 59±9%, p=0.152).The spreading pattern of mediastinal nodes among pN2 cases was featured by tumor location. The most frequent involved station for right upper lobe-located lung cancer was 4R (83.7%), followed by 7 (37%) and 2R (14.0%). The top 3 involved stations for other cancer locations were 7 (75%), 4R (25%) and 2R (6.3%) for right middle lobe; 7 (81.6%), 4R (34.2%) and 2R (10.5%) for right lower lobe; 5+6 (90.9%), 4L (22.7%) and 7 (4.5%) for left upper lobe; 7 (66.7%), 5+6 (42.4%) and 8 (9.1%) for left lower lobe. Figure 1



Conclusion:
Mediastinal lymphadenectomy fulfilling with NCCN criteria may only improve the survival of pathological upstaging subgroup (cN0/1-pN2) among patients with clinical early-stage lung cancer. More extended dissection of mediastinal lymph node (≥ 4 stations) may not further improve the outcome in this group.

Abstract not provided

Background:
Neuroendocrine lung tumours account for 25% of all lung cancer cases, and they range from low-aggressive pulmonary carcinoids (PCA) to highly malignant small-cell lung cancer (SCLC) and large-cell neuroendocrine lung carcinoma (LCNEC). The last two are strongly associated with heavy smoking and are typically detected at a clinically advanced stage, having a poor survival. Comprehensive genomic analyses in lung neuroendocrine tumours are difficult because of limited availability of tissue. While more effort has been done in the context of SCLC, the detailed molecular features of LCNEC remain largely unknown.

Methods:
We conducted 6.0 SNP array analyses of 60 LCNEC tumours, exome sequencing of 55 tumor-normal pairs, genome sequencing of 11 tumour-normal pairs, transcriptome sequencing of 69 tumours, and expression arrays on 60 tumors. Data analyses were performed using in house developed and published pipelines.

Results:
Analyses of chromosomal gene copy number revealed amplifications of MYCL1, FGFR1, MYC, IRS2 and TTF1. We also observed deletions of CDKN2A and PTPRD. TTF1 amplifications are characteristic of lung adenocarcinoma (AD); CDKN2A deletions are frequent alterations in both AD and squamous-cell lung carcinoma (SQ); FGFR1 amplifications are found in SQ and, less frequently, in SCLC; and MYCL1 and IRS2 amplifications are frequent events in SCLC. Similar to the copy number data, we found patterns of mutations characteristic of other lung cancer subtypes: TP53 was the most frequently mutated gene (75%) followed by RB1 (27%), and inactivation of both TP53 and RB1, which is the hallmark of SCLC, occurred in 20% of the cases. Mutations in STK11 and KEAP1-NFE2L2 (frequently seen in AD and SQ) were found in 23% and 22% of the specimens, respectively. Interestingly, mutations in RB1 and STK11/KEAP1 occurred in a mutually exclusive fashion (p-value=0.016). Despite the heterogeneity observed at the mutation level, analysis of the pattern of expression of LCNEC in comparison with the other lung cancer subtypes (AD, SQ, SCLC, and PCA) points to LCNEC as being an independent entity. An average mutation rate of 10.7 mutations per megabase was detected in LCNEC, which is in line with the rate observed in other lung tumours associated with smoking. We found that, similar to SCLC, the mutation signatures associated with APOBEC family of cytidine deaminases, smoking, and age (based on Alexandrov et al 2013) were the predominant ones in LCNEC. However, the contribution of the individual SCLC and LCNEC samples to these three signatures was quite different, and we are currently exploring it.

Conclusion:
Taking into account somatic copy number and mutation data, we distinguished two well-defined groups of LCNEC: an SCLC-like group, carrying alterations in MYCL1, ISR2, and in both RB1 and TP53; and a group resembling AD and SQ, with alterations in CDKN2A, TTF1, KEAP1-NFE2L2, and STK11. Although these results suggest that LCNEC might be a mix of different lung cancer subtypes, mutation clonality and expression analyses show that they are likely to be a separate entity, sharing molecular characteristics with the other lung cancer subtypes. Their heterogeneity suggests that LCNEC might represent an evolutionary trunk that can branch to SCLC or AD/SQ.

Background:
Identification of clinically relevant molecular drivers in patient tumors is essential in selecting appropriate targeted therapy. Using next-generation sequencing (NGS) -based clinical cancer gene test, we performed genomic profiling of lung adenocarcinoma tumors.

Methods:
We collected formalin-fixed paraffin-embedded tumors from 41 lung adenocarcinoma patients whose tumors previously tested negative for EGFR/KRAS/ALK by conventional methods in an ongoing trial (NCT01964157). We performed hybridization capture of 4,557 exons from 287 cancer-related genes and 47 introns from 19 genes frequently rearranged in cancer (FoundationOne). Illumina HiSeq2000 platform was used to sequence to high uniform depth.

Results:
Figure 1Tumors were sequenced to a median coverage of 529x. Overall, we identified a total of 170 known and 492 unknown individual genomic alterations. The number of known alterations per sample was average of 3.8 alterations (range 0-10). Cancer genomes are characterized by 45% (77/170) non-synonymous base substitutions, 17% (29/170) insertions or deletions, 2% (4/170) splice site mutations, 20% (34/170) gene amplifications, 5% (8/170) homozygous loss and 5% (8/170) gene fusions. TP53 was the most commonly mutated gene (13%, n=10/77) among non-synonymous base substitutions, followed by KRAS (10%, n=8/77) and PIK3CA (8%, 6/77). Insertions or deletions commonly occurred TP53 (17%, 5/29) and ERBB2 (14%, 4/29), and splice site mutations occurred in TP53, INPP4B, ATR, and MAP2K4 (n=1 each). Among gene amplification, MDM2 amplification was the most frequent (12%, 4/34), followed by ERBB2 (8%, 3/34) and CDK4 (8%, 3/34) amplification. All 8 cases of homozygous loss were observed with CDKN2A and CDKN2B. Fusion genes were most commonly observed with RET (50%, n=4/8). Based on NCCN guidelines, actionable genomic alterations with a targeted agent were identified in 16 patients (39%) (BRAF mutation [n=1], EGFR mutation [n=7], ERBB2 mutation [n=4], MET amplification [n=1], KIF5B-RET rearrangement [n=2], CCDC6-RET rearrangement [n=1], and CD74-ROS1 rearrangement [n=1]). Nine out of all patients (22%) showed discordance in targetable alterations when compared between NGS and conventional non-NGS methods.



Conclusion:
Thirty-nine percent of lung adenocarcinoma wild type for EGFR/KRAS/ALK may harbor a genomic alteration revealed by NGS approach. These results highlight the importance of profiling lung adenocarcinomas using NGS in the clinic.

Background:
Genome wide SNP array studies have identified systematic gene copy number aberrations (CNA) in non-small cell lung cancer (NSCLC), but their prognostic implication is unknown. This study aimed to investigate associations between CNAs and survival using the LACE-Bio bio-bank. The LACE-Bio consortium includes large clinical trials comparing adjuvant platinum-based chemotherapy to observation after complete resection of stage I-III NSCLC.

Methods:
DNA was extracted from FFPE tumor samples from 3 pivotal adjuvant chemotherapy trials (CALGB 9633, IALT, JBR.10); 1013 samples were profiled using Affymetrix OncoScan[TM] arrays with over 300,000 probes and normalized relative to a pool of normal tissues. Segmentation was performed using the CBS algorithm and minimally recurrent regions (MCR) across the series identified by CGHregions. All analyses were performed on the level of MCRs. CNAs were correlated with clinicopathological factors and adjusted for the False Discovery Rate (FDR). The primary endpoint, disease-free survival (DFS), was assessed via univariate Cox models stratified by trial and adjusted for treatment, age, sex, PS, histology, T, and N stage.

Results:
Among 976 successfully profiled samples, 414 (42%) were adenocarcinoma (ADC), 430 (44%) squamous cell carcinoma (SCC) and 132 (14%) other NSCLC; 710 (73%) were male. Across the 431 MCRs identified, patients had on average 94 (SD 69) CNAs: 51 gains and 43 losses. A gain or loss was observed in at least 10% of patients for 177 and 166 regions respectively. The most common gains (up to 48%) were on chromosomes 1p, 3q, 5p, 6p, and 22q. The most common losses (up to 40%) were on chromosomes 3p, 8p and 9p. The size of 253 of the 431 MCRs (59%) was smaller or equal to 3Mb (and 79% ≤10 Mb). Sensitivity analyses on the subset of samples with optimal quality (n=777, defined by MAPD<0.3) gave consistent results. The CNA frequency of 195 regions was significantly different with FDR≤0.05 between ADC and SCC (of which 49% regions of size ≤3Mb and 71% ≤10Mb); the most significant were more gains in 3q, 22q and 12 in SCC and more losses in 3p, 4, 5q in SCC. With a median follow-up of 5.3 years, 510 DFS events and 451 deaths were recorded. In univariate analyses for DFS, 13 regions in loci 19p11–13, 7p12, 9p21, 15q14 had a raw p-value <0.005 (FDR<0.13, the top 8 corresponded to FDR≤0.05); 9 of those 13 regions were of size ≤3Mb (12 regions ≤10Mb). In adjusted analyses, 10 of the 13 regions retained raw adjusted p-values ≤0.005 (FDR≤0.15). Losses of focal regions including CDKN2A/B and STK11 (≤3Mb) were associated with poorer DFS: the hazard ratio (HR) for a 2-fold copy number decrease in region 9p21.3 (including CDKN2A/B) was 1.50 (95% CI: 1.2–1.9, P<0.001, FDR=0.02), and the HR for a 2-fold copy number decrease in 19p13 (including STK11) was 2.4 (1.3–4.3, P=0.005, FDR=0.15). Similar results were obtained for overall survival and lung-cancer specific survival. Results of histology-specific analyses will be presented.

Conclusion:
These large-scale genome-wide analyses of gene CNA provide new candidate prognostic markers for stage I-III NSCLC.

Abstract not provided

Background:
Molecular biology has changed the treatment of advanced NSCLC, leading to many small subgroups of patients (pts) eligible for targeted therapies, many of them being not approved. Since 2010 we created a monthly MTB dedicated to NSCLC pts with potential driving molecular abnormalitie(s). MTB includes expert physicians from the lung tumor board and phase I unit, radiation therapists, researchers, geneticists, pathologists and biologists. A medical report summarizes the findings and treatment recommendations for each pts. We report 4 years of activity of MTB at Gustave-Roussy.

Methods:
All consecutive files discussed in MTB for a NSCLC were reviewed. MTB included pts with at least one molecular alteration based on a 75 gene panel (NGS analysis and FISH for ALK, HER2, MET, FGFR1, ROS1 and RET). Tumor and pts characteristics were collected as well as treatments. Pts outcome was calculated from the MTB date. Kaplan-Meier methods, and Cox proportional hazards models were used for survival analysis, adjusting for sex, histology, smoking status, metastasis at diagnosis, number of line(s) before MTB.

Results:
502 files were discussed between 02/2010 and 09/2014. Median age was 60 yrs (25–88 yrs), 53% were male, 86% Caucasian, 26% never-smokers, and 93% had PS ≤1. Initial clinical stage was III-IV in 417 pts (84%) and 79%/10%/11% were adenocarcinomas/squamous cell carcinomas/others NSCLC. Median number of treatment-lines before MTB was 1 (0-10), 86% were previously treated by a platinum-based chemotherapy regimen, 17% in a therapeutic trial, and median time from diagnosis to MTB was 5 months. Biopsy for Molecular Analysis (MoA) mostly came from CT guided biopsies (62%), surgery (21%) or endoscopy (16%). Biopsy was repeated in 19% of pts to get enough material for MoA. The MoA results were ALK rearrangement in 11%, exon 18/19/20/21 EGFR mutation (mut) in 2/14/4/7% respectively, KRAS mut in 32%, PI3KCA mut in 3%, BRAF mut in 5%, HER2 mut (Exon 20) in 2%, HER2 amplification in 2%, FGFR1 amplification in 3%, MET amplification in 3% and other rare mutations in 27%. MTB recommended a targeted therapy in 344 pts (68%) either within clinical trials (57%), EMA approved therapy (23%), an off label drug (9%), or an expanded access program (11%). 162pts (47%) actually received the recommended therapy, 141 (41%) did not and 41 (12%) might receive it at the time of progression. Median follow-up was 24 months (1-24; follow-up censored after 24 months). Median OS was 13.1 months [95%CI: 8.8; 18.2] for non-oriented pts, and 14.3 months [11.5; 16.7] for oriented pts (p=0.39). We observed a significant difference between EGFR/ALK/ROS1 mutated/rearranged pts (median 23.8 months) vs. pts with KRAS (8.6 months) or others mutations (11.1 months) or non-oriented pts (13.1 m; p=0.0008, HR=0.56, 1.15 and 0.97 respectively compared to non-oriented).

Conclusion:
MTB is feasible in daily practice with treatment recommendations in a majority of NSCLC pts (68%), enrichment in clinical trials or expanded access programs, and limitation of off-label drugs use. Benefit on survival for all oriented pts has to be clarified based on the type of molecular abnormality. Update results will be presented at the meeting.

Background:
Testing for biomarkers including EGFR mutations and ALK rearrangements is standard of care in the management of advanced non-small cell lung cancer (NSCLC), as it determines optimal systemic therapy (ST). Our centre began EGFR testing March 2010 and ALK April 2012. Initially, EGFR/ALK were requested by medical oncologists (MO) when patients were deemed eligible for EGFR or ALK targeted therapy. To expedite biomarker information to MO for rapid initiation of ST in patients with advanced stage or earlier stage disease that developed recurrence, June 2013 we implemented a multidisciplinary approach termed “reflex testing”. This was defined as our pathologists requesting EGFR/ALK at time of diagnosis of non-squamous NSCLC irrespective of a patient’s clinical stage. If tissue was at an outside centre, clerical staff requested EGFR/ALK at time of referral to MO. The objective of this study was to determine if reflex testing improved time-to-treatment (TTT) and the integration of personalized medicine in patients with advanced NSCLC.

Methods:
This was a retrospective chart review of patients with non-squamous NSCLC seen by MO at the Sunnybrook Odette Cancer Centre from March 18, 2010 to April 30, 2014. Patient and EGFR/ALK test characteristics were compared before and after reflex testing was implemented using Chi-square tests of association. Time outcomes were compared using Mann-Whitney U non-parametric tests. TTT was defined as the interval between first MO visit with advanced NSCLC to initiation of ST.

Results:
Of the 301 patients included, median age was 68, 43% female, 65% Caucasian, 75% smokers, 93% adenocarcinoma, 22% EGFR positive and 1% ALK positive. The majority presented with stage IV (65%) and 82% either presented with or developed advanced NSCLC. In advanced NSCLC patients (n=247), reflex testing significantly reduced median TTT compared to routine testing [(24 days (IQR: 7 to 42) vs. 36 days (IQR: 16 to 72), p=0.04)], reduced the rate of EGFR unknown (4% vs. 26%, p=0.002) and ALK unknown (10% vs. 50%, p<0.001). There was minimal impact on advanced NSCLC patients receiving any first-line ST (58% vs. 63%, p=0.48). However, among these patients, with reflex testing, fewer were initiated on first-line ST without biomarker results known by MO (EGFR 23% vs. 39%, p=0.12, ALK 17% vs. 42%, p=0.02), and at last follow up significantly fewer had EGFR unknown (0% vs. 13%, p=0.004) and ALK unknown (7% vs. 38%, p=0.003). Across all stages, rates of EGFR results available to MO at first consultation increased (34% vs. 4%, p<0.001). Reflex testing also impacted the quality of biomarker testing with a decrease in unsuccessful EGFR tests due to inconclusive results, insufficient or inappropriate tissue, or tissue not sent from holding lab to testing lab (4% vs. 15%, p=0.03).

Conclusion:
A multidisciplinary approach to earlier biomarker testing in NSCLC is feasible. Reflex testing for EGFR/ALK improved TTT and the integration of personalized medicine for patients with advanced NSCLC by improving biomarker testing rates, the quality of testing and fewer patients given ST without biomarkers known. These outcomes provide support for reflex EGFR/ALK testing by pathologists at time of diagnosis of non-squamous NSCLC.

Background:
The Network Genomic Medicine (NGM) Lung Cancer is an interdisciplinary and intersectoral network offering comprehensive and centralized next generation sequencing (NGS)-based multiplex genotyping for all inoperable lung cancer patients in Germany. In 2014 NGM and the AOK Rheinland/Hamburg, one of the largest German public health insurances, have successfully contracted and established the first "flat rate" cost reimbursement model for NGS-based comprehensive lung cancer genotyping in Europe. After a year the first joint health-economic evaluation of NGM patients was initiated.

Methods:
The AOK Rheinland/Hamburg cooperates with NGM within the integrated care contract (ICC) according to § 140 German Social Insurance Code. Besides the cost reimbursement model for the NGS-based diagnostics the ICC comprises optional second opinion consultation hours and a joint evaluation program. The NGS panel used for all patients currently consists of 14 genes and 102 amplicons to cover potentially targetable aberrations. Other German public and private health insurances are currently negotiating to join the ICC. In April 2015 we elaborated a model to analyze molecularly guided therapy cost and outcome of inoperable lung cancer patients integrating health insurance cost data (diagnostic, therapy and drug-related costs). This model includes NGS-based molecular diagnostic results, treatment strategies and cost-effectiveness. Additionally, time-points of molecular genotyping and their influence on patient-related outcome and quality of life will be examined.

Results:
In 2014 about 4500 lung cancer NGM patients were centrally genotyped on the central NGS platform in Cologne. Since April 2014 167 patients, insured by the AOK Rheinland/Hamburg, consented for ICC. 149 patients received NGS-based molecular diagnostic of their tumors. 18 samples were not suitable for testing. ICC patients were stratified according to their molecular diagnostic results and molecular guided therapy options (targeted drugs including off-label use, participating in clinical trials or standard chemotherapy). Clinical outcome data were collected within NGM (by over 200 clinical partners) and reimbursement data are provided by the AOK Rheinland/Hamburg. This model will be extended to all NGM patients independent of their insurance status. Final cost-effectiveness and outcome data will be presented.

Conclusion:
NGM stands for the implementation of personalized cancer therapy into clinical routine in Germany. Now we systematically evaluate NGS-based molecular results, clinical outcome and cost-effectiveness data besides of clinical trials. First-time in Europe data evaluation is provided in a close cooperation between health care providers and health insurance companies and even matching the patient’s data. Furthermore, in 2015 a joint database (NGM Cancer Information System) for retrospective evaluation of personalized cancer treatment in Germany will be launched. Our model of implementing personalized cancer care in broad clinical routine is currently transferred to other tumor entities.

Abstract not provided

Background:
Smoking is the number one risk factor for lung cancer worldwide. Recent data indicate that stem cells situated throughout the small airway epithelium may initiate cancer formation following direct exposure to inhaled carcinogens. In the present study we sought to generate induced pluripotent stem cells (iPSCs) from normal human small airway epithelial cells (SAECs) in order to investigate epigenetic mechanisms contributing to the cancer stem cell initiation process, and possibly identify novel targets for lung cancer therapy.

Methods:
Several different stocks of SAEC were transduced with Stemcca virus containing OKSM (Yamanaka factors); multiple randomly selected clones were expanded for further analysis. Spectral karyotyping was performed to confirm the purity of pluripotent cells. iPSC cells were injected in SCID mice to study teratoma formation. RNA and DNA were extracted from iPSC and parental SAEC for qRT-PCR and RNA-Seq analyses, as well as pyrosequencing of LINE-1, NBL2 and D4Z4 DNA repetitive elements, and promoter regions of several differentially regulated genes.

Results:
SAEC were reprogrammed to a pluripotent state. Generated iPSCs demonstrated hallmarks of pluripotency including morphology, proliferation, expression of surface antigens, stemness gene expression, and in vivo teratoma formation. Interestingly, no chromosomal aberrations were observed in iPSCs. Pyrosequencing did not demonstrate any significant changes in LINE-1, NBL2 and D4Z4 DNA methylation levels in iPSC compared to parental SAEC, suggesting relatively limited global hypomethylation following reprogramming. Consistent with these observations, cancer-testis genes such as NY-ESO-1, MAGE-A1 and MAGE-A3, which are frequently upregulated by DNA demethylation in lung cancer cells, remained transcriptionally repressed in the iPSC. On the other hand, NANOG and POU5F1 genes were hypomethylated in iPSCs relative to SAEC, correlating with their over-expression in iPSCs. RNA-Seq analysis revealed up-regulation of genes encoding components of Polycomb-Repressive Complex 2 (PRC2), and down-regulation of several tumor suppressor genes such as DKK1, p16 and p21 in iPSC relative to parental SAEC. Several novel pluripotency associated genes were also noted to be up-regulated in pulmonary iPSC, which are the focus of ongoing mechanistic studies.

Conclusion:
This is the first report demonstrating successful reprogramming of human respiratory epithelia to pluripotency. This model may prove useful for elucidating fundamental epigenomic mechanisms of pulmonary carcinogenesis and identification of novel targets for lung cancer therapy.

Background:
What defines the high risk airway epithelium for lung cancer remains a major challenge. Airway epithelium is prone to assault by the risk factors and considered to be the primary cell type involved in the field cancerization. Transcriptomic aberrations in the airway epithelium of individuals at risk for lung cancer have been reported earlier. However, very limited information exists about proteomic alterations in the airway epithelium. We investigated the molecular underpinnings of risk from proteomic alterations in the cytologically normal airway epithelium from individuals at risk for developing lung cancer.

Methods:
Bronchial brushings specimens were collected from individuals categorized as low, medium and high risk groups based on Bach risk model. Shotgun proteomic profiling data were acquired by liquid chromatography-tandem mass spectrometry (LC-MS/MS). Proteins were identified using a combination of database search tools and candidate proteins were selected based on Jonckheere-Terpstra trend analysis. Pathway analysis was performed using WebGestalt. In vitro model of human bronchial epithelial cell line treated with cigarette smoke condensate (CSC) was used for metabolic flux experiments by gas chromatography mass spectrometry (GC MS) analyses.

Results:
We identified 2901 proteins in bronchial epithelial cells from risk stratified individuals. Jonckheere-Terpstra trend test resulted significantly altered expression of 315 proteins (trend p <0.05) with 238 up and 77 down trends. KEGG pathway analysis with the 315 proteins revealed very early events of possible metabolic reprogramming in the cytologically normal bronchial epithelium of individuals at high risk for lung cancer development. Fourteen enzymes of the glycolytic pathway, TCA cycle, pentose phosphate pathway, and glycogenolysis were over expressed. Six of these fourteen enzymes, PYGB, PFKP, PFKL, PKM2, IDH1, and IDH2 were rate limiting enzymes. In in vitro culture of human bronchial epithelial cells treated with CSC, lactate production and glucose consumption were increased suggesting Warburg effect and metabolic reprogramming. Evidence of glutamine metabolism through reductive carboxylation in CSC treated cells was obtained from the metabolic flux analyses of cells from this in vitro model. Contribution of labeled carbon from [U-[13]C5]-glutamine to TCA cycle in CSC treated cells were more than untreated control cells and there was strong M+5 citrate labeling in CSC-treated cells.

Conclusion:
Shotgun proteomic analysis of cytologically normal bronchial epithelial cells in individuals at increasing risk for lung cancer revealed over expression of carbohydrate metabolic enzymes in high risk individuals suggesting possible metabolic reprogramming. The altered profile of metabolic enzymes may provide a signature of lung cancer risk assessment and serve as the basis of patient selection for surveillance programs and chemoprevention.

Background:
Lung cancer is the most lethal cancer type worldwide. In order to increase patient survival it is important to improve our understanding of the early changes associated with lung cancer progression. The progression of lung squamous cell carcinoma (SqCC) from pre-invasive lesions involves a series of histological changes which includes squamous metaplasia, mild, moderate and severe dysplasia, and carcinoma in situ (CIS). In these pre-invasive lesions the basement membrane is intact and there is no possibility of metastatic spread, which is in contrast to SqCC where there is the potential for metastasis as soon as invasion occurs. Our laboratory has a unique cohort of patients with pre-invasive lung SqCC lesions. Within this cohort there is a discrepancy between the prevalence of pre-invasive lesions and the incidence of invasive lung cancer, which suggests that not all pre-invasive lesions progress to invasive carcinomas. This tissue collection forms an internationally unique resource of lesions and will shed light on the molecular characteristics of lesions that progress compared to those that either regress or remain stable. The aim of this study was to identify and characterize key genes involved in the early pathogenesis of lung SqCC.

Methods:
Following histological review by two histopathologists to confirm that pre-malignant tissue is present in the biopsy specimens, the epithelial component of interest was laser-capture micro-dissected. This is vital in order to eliminate any cross-contamination from unwanted cells and to ensure that pre-invasive CIS specific gene expression profiles are generated. We have performed genome-wide gene expression Illumina’s Whole-Genome DASL® arrays in 20 progressive and 19 regressive pre-invasive lung SqCC lesions. The protein expression of Matrix metallopeptidase 12 (MMP12) and LIM domain 7 (LMO7) was also determined in the 39 pre-invasive lung cancer lesions by immunostaining analysis. The functional role of MMP12 and LMO7 in cell migration and invasion was demonstrated by MMP12 and LMO7-shRNA knockdown in different squamous cell carcinoma cell lines and human bronchial epithelial cells (HBECs), respectively.

Results:
We found 939 genes significantly differently expressed between the progressive and the regressive pre-invasive lung SqCC lesions. We identified a remarkably elevated expression of a spectrum of genes in the progressive lung SqCC lesions involved in different related cancer pathways including chromosome instability, p53 signalling and Wnt/β-catenin signalling. MMP12 and LMO7 were found within the highest significantly differently expressed genes and were therefore chosen to pursue studies focused on understanding the potential mechanisms leading to the development of lung SqCC. In agreement with the gene expression data the expression of MMP12 and LMO7 proteins were up-regulated and down-regulated, respectively, in progressive when compared with regressive lesions. Inhibiting MMP12 by MMP12 knockdown significantly reduced the migration and invasion of different squamous cell carcinoma cell lines (A431, H357 and H376). We also established HBECs knockdown targeting LMO7. We observed a significant increase in the migration and invasion of HBECs cells in the LMO7 shRNA knockdown compared to control.

Conclusion:
Our results suggest that MMP12 and LMO7 may be potential therapeutic markers for lung cancer at early stage.

Abstract not provided

Background:
Cancer Initiating Cells (CICs) and their niches may open new avenues in the pathogenesis and management of lung cancer. A relevant component of the niche is represented by supportive stromal cells that control the fate of CICs by a reciprocal cross-talk. The understanding of these cellular events could represent a significant advancement in cancer biology and treatment. Recent observations by our and other laboratories have suggested that mesenchymal stromal cells (MSC) regulate lung cancer growth and resistance, thus generating large expectations in novel anti-cancer strategies. The aim of our study was to determine whether MSC isolated from NSCLC and from non-neoplastic human lung samples possess different biologic properties and tumorigenic potential.

Methods:
Fresh samples of neoplastic and spared lungs from 58 male patients (80% smokers) affected by primary pulmonary adenocarcinoma undergoing surgical resection were processed. Stromal cells were separated from epithelial cells by negative selection using EpCAM (CD326)-based immunomagnetic sorting. After further enrichment, we could expand for at least 14 passages a population of CD90, CD105, CD73 and CD44 positive MSC from lung cancer (Lc-MSC) and non-neoplastic (Nn-MSC) lung tissue. The oncogenic potential of these cells from the same patient was tested on a Calu-3-based in vitro model of NSCLC by co-culture and conditioned media (CM) and in vivo by xenotransplantation in Balb/c Nude mice. In vivo cell tracking was achieved by pre-labeling MSC with Quantum dots 585 (Qdots). Morphometric assessment of tissue composition and immunofluorescence combined with FISH analysis of human X and Y chromosomes was performed on xenografted tumors.

Results:
Nearly 30x10[6] cells could be typically obtained after 3 passages in each case, however, compared to Nn-MSC, cultures of Lc-MSC displayed lower growth kinetic and mitotic index while higher survival and HIF-1-alpha (Hypoxia-inducible-factor-1) upregulation in response to hypoxia was observed. A larger fraction of Lc-MSC expressed transcription factors involved in stemness (Oct3/4, SOX2) and in bronchioalveolar (TTF1, ETS-1, CCL10) commitment. Co-cultures demonstrated that Lc-MSC significantly increased Calu-3 growth as compared to Nn-MSC in transwell assay and by contact. CM from Lc-MSC similarly promoted Calu-3 expansion as compared to Nn-MSC. When 2.5x10[6] Lc-MSC or Nn-MSC from the same patient were subcutaneously co-injected with Calu-3, a 38% and 17% increase in tumor volume was respectively observed, compared to the injection of an equal number of Calu-3 alone (CTRL). Lc-MSC or Nn-MSC injected alone did not generate tumors. Quantitative estimation of the in vivo expansion of neoplastic cells indicated that the addition of Lc-MSC increased by 6-fold and 29-fold Calu-3 replication compared to Nn-MSC and CTRL, respectively. Cell tracking documented that Qdots labelled MSC were located at the boundary of neoplastic epithelial glands generated by X-chromosome polysomic Calu-3 cells. A comparative molecular analysis of Lc-MSC and Nn-MSC is ongoing for the identification of distinctive signalling pathways implicated in the microenvironemental control of CIC on NSCLC development.

Conclusion:
Profound differences exist in the biology and oncogenic potential of intratumoral and normal lung MSC strongly supporting the notion that the tumor microenvironment may represent a potential target of new customized therapeutic strategies.

Background:
Squamous cell carcinoma (SCC) of the lung is the second most common subtype of lung cancer with limited treatment options and a poor survival rate. Until recently, mouse models of SCC have been limited.

Methods:
Using lentiviral delivery of Sox2 and Cre recombinase to the mouse lung, we tested the ability of Sox2 to promote tumorigenesis in multiple tumor suppressor backgrounds. Mouse lungs were imaged for tumor formation using micro-CT imaging. Resulting mouse tumors were evaluated for histological markers including Nkx2.1, Sox2, p63, cytokeratin-5, cytokeratin-14 and compared to human squamous tumors. Phospho-signaling proteins including pAkt, pErk, pStat3, pAMPK, p4EBP1 were also evaluated in mouse and human tumors by immunohistochemistry.

Results:
Expression of Sox2 specifically cooperates with loss of Lkb1 to promote squamous lung tumors. Importantly, Sox2 expression and mTOR pathway activation frequently co-occur in human squamous tumors. Mouse squamous tumors exhibit characteristic histopathology and biomarker expression similar to human SCC. They also mimic human SCCs by activation of therapeutically relevant pathways including STAT and mTOR. Sox2 expression is sufficient to induce phosphorylated Stat3 in vitro (Mukhopadhyay et al, Cell Reports, 2014). Sox2-driven tumors also exhibit immune cell infiltration consistent with other squamous lung cancer models.

Conclusion:
This mouse model of Sox2-driven squamous lung cancer may be a useful model to study immunotherapies and their mechanism of action. This model may also be used to test the contribution of additional driver alterations in SCC, as well as for preclinical drug discovery. Our data suggest mTOR, Jak-Stat and immunotherapies may be relevant targets for squamous lung cancer.

Background:
Non-small-cell lung cancer (NSCLC) is featured with genetic and histopathological heterogeneity. LKB1-mutant NSCLC represents a unique and prevalent molecular subtype with limited treatment options. Originally characterized as a tumor suppressor, LKB1 phosphorylates and activates several downstream targets to inhibit cell growth; on the other hand, LKB1 also regulates cellular energy sensing and metabolic homeostasis. This raises an interesting question about how LKB1 inactivation coordinates in vivo lung tumor progression with metabolic adaptation. We have shown recently that the Kras/Lkb1 lung tumor heterogeneity results from p63-mediated ADC to SCC transdifferentiation (AST) through mixed Ad-SCC at late stage, suggesting an unexpected plasticity upon LKB1 inactivation in NSCLC. However, it remains unclear how LKB1 inactivation coordinates tumor progression with metabolic adaptation in orchestrating this tumor plasticity.

Methods:
We integratively analyze the transdifferention process of mouse lung adenocarcinoma to squamous cell carcinoma in Kras/Lkb1 Adeno-Cre nasal inhalation model as well as the lineage-defined Kras/Lkb1 model. Moreover, we have also systematically analyzed the clinical lung adenosquamous cell carcinoma to prove the findings from our animal models.

Results:
Here in Kras[G12D];Lkb1[lox/lox ](KL) mouse model, we reveal differential reactive oxygen species (ROS) levels in lung adenocarcinoma (ADC) and squamous cell carcinoma (SCC). ROS can functionally modulate the ADC-to-SCC transdifferentiation (AST). Furthermore, pentose phosphate pathway deregulation and impaired fatty acid oxidation collectively contribute to the redox imbalance and functionally affect AST. Similar tumor and redox heterogeneity also exist in human NSCLC with LKB1 inactivation. In preclinical trials towards metabolic stress, certain KL ADC can develop drug resistance through squamous transdifferentiation. This study uncovers critical redox control of tumor plasticity that may affect therapeutic response in NSCLC.

Conclusion:
LKB1-mutant tumor represents a unique and prevalent molecular subtype of NSCLC with limited treatment options. Through integrative human lung cancer sample analysis and modeling tumor development in mouse model, we have uncovered the accumulation of ROS during ADC progression, which modulates the phenotypic transition as squamous transdifferentiation and metabolic adaptation. This metabolic adaptation reflects the dynamic function of LKB1: a tumor suppressor at early lung ADC progression and an essential metabolic regulator at late phenotypic transition. The redox-controlled tumor plasticity for squamous transdifferentiation enables ADC to progress under stress, and more importantly to escape certain treatment towards cancer metabolism. The plasticity represents as a potentially important mechanism for lung cancer metabolic adaptation and drug resistance, and holds important therapeutic implications.

Abstract not provided

Background:
This presentation reviews the history of tobacco litigation in the United States.

Methods:
Data for this study comes from industry business records available online through the UCSF Legacy Tobacco Documents Library, transcripts of court proceedings, and news and stock analyst reports on tobacco litigation.

Results:
Litigation against the tobacco industry began in 1954, corresponding to the emerging evidence linking smoking and disease. A total of 109 lawsuits were filed between 1954 and 1970, but only eight were tried and all ended in defense verdicts. Another 150 cases were filed between 1970 and 1985, but none went to trial. There was a second wave of cases filed during the mid-1980s that led to jury trials, but only one, Cipollone v. Liggett Group, was a plaintiff verdict. Cipollone was later overturned on appeal. A third wave of litigation followed in the early 1990s, with several plaintiffs’ verdicts. By 1999, juries were awarding punitive damages against the defendants. The state Attorney General cases against cigarette manufacturers resulted in the Master Settlement Agreement in 1998, which, among other things, required that the cigarette companies release millions of pages of business records. These documents have played a key role in fueling subsequent litigation and winning cases. The Engle v. Liggett Group class action verdict on behalf of injured smokers in Florida in the late 1990s helped to change the industry’s long held position that smoking was unproven as a cause of disease and that nicotine was not addictive. Decertification of the Engle class action lawsuit spawned several thousand individual lawsuits against the cigarette industry in Florida, which have resulted in dozens of verdicts favoring plaintiffs since 2009. Additional litigation against the tobacco industry continues nationwide on the “light” cigarettes fraud and on individual personal injury cases that have resulted in notable verdicts against the tobacco industry.

Conclusion:
In the United States, litigation against the cigarette industry began in 1954 and has accelerated over the past 60 years with a growing number of verdicts favoring plaintiffs since the mid-1990s. Litigation has proven to be a powerful tool for tobacco control efforts helping to change public sentiment about the industry and its products, increasing the costs of cigarettes, and forcing the industry to accept responsibility, in front of a jury, for its deceptive practices.

Background:
Cigarette smoking is the major cause of lung cancer. Many adults smoke at the time of a lung cancer diagnosis and continue to smoke during treatment although doing so adversely affects treatment response, quality of life, and survival time. While authoritative bodies recommend that tobacco use be addressed in lung cancer care, few patients receive effective treatment. The coordinated multidisciplinary model of care delivery, in which patients, their caregivers, and key specialists concurrently develop evidence-based care, offers an ideal setting to integrate high quality cessation treatment. To assess the need for and acceptability of cessation services, we surveyed patients about their smoking status, interest in quitting, and willingness to participate in a clinic-based cessation program.

Methods:
The study was conducted in the Multidisciplinary Thoracic Oncology Program at Baptist Cancer Center, Memphis TN. One-hundred eight consecutive new patients, seen between 7/31/13 and 9/24/14, completed a social history questionnaire. From this history, we extracted data related to sociodemographic characteristics (age, gender, race, marital status), smoking status, age of smoking initiation, and tobacco dependence (using the Heaviness of Smoking Index, consisting of cigarettes smoked per day and time of first cigarette of the day). Current smokers reported their level of interest in quitting, and how likely they would be to participate in a cessation program (‘I would not participate’; ‘I might participate but am not sure’; ‘I would participate’). Chi square tests were used to compare characteristics of those who would participate in the stop-smoking program vs. those who would not or were unsure whether they would participate.

Results:
Average age of patients was 65 years (range: 29-91), 41% were men, 58% were white, 39% black, and 15% had graduated college. Patients’ cancer stage broke down to stage I (16%), stage II (9%), stage III (18%), stage IV (28%), and undetermined (29%). 84% of patients had ever smoked cigarettes, 35% currently smoked, and 11% had quit smoking within the past year. Among current smokers, 71% (n=27) were “very interested” in quitting smoking in the next month and of these, 74% reported that they would be willing to participate in a smoking cessation program in the clinic. Willingness to participate in a cessation program was associated with greater interest in quitting (χ[2][1]= 13.3, p=.0003), but was not associated with sociodemographic characteristics, cancer stage, or smoking-related characteristics (amount smoked, age at smoking initiation, or dependence).

Conclusion:
Nearly half (46%) of patients in a community-based multidisciplinary thoracic oncology program were current cigarette smokers or had quit within the previous year, indicating a considerable need for cessation and relapse-prevention support. Encouragingly, a majority of current smokers were highly motivated to make a quit attempt in the next month, and most indicated that they would take advantage of a clinic-based cessation program. Willingness to participate in a cessation program was similar across a broad range of sociodemographic, cancer stage, and nicotine dependence levels. There is considerable need for, and interest in, smoking cessation services in the setting of community-based multidisciplinary lung cancer care.

Background:
It is well documented that active smoking affects the overall mortality in lung cancer. Smoking cessation has been associated with better prognostic outcomes in patients with early stage non-small cell lung carcinoma (NSCLC) and limited stage small cell lung carcinoma (SCLC). Smoking cessation impact in advanced stage NSCLC is less well characterized. We studied the benefit of smoking cessation, before the initiation of chemotherapy, on overall survival (OS) in advanced NSCLC.

Methods:
We retrospectively reviewed the clinical data of 306 patients with stage IV SCLC and NSCLC between 2008 and 2014 in our centre. The 237 NSCLC patients treated with at least one cycle of chemotherapy are the subjects of this study. Smoking status and smoking cessation duration at the chemotherapy initiation time, number of packs/years, comorbidities, histology, sites of metastases, type and number of cycles of chemotherapy were all collected. Never-smokers were defined by a smoking history of < 100 cigarettes during their entire lifetime. Survival curves were calculated by the Kaplan-Meier method and compared using log-rank test. Cox proportional hazard models were used for multivariable analyses.

Results:
Smoking cessation before the initiation of chemotherapy is associated with a better median overall survival of 16 vs 10 months (p=0.007). This is even seen in heavy smokers of > 30 pq/year, with a median OS of 15 vs 8 months (p=0.008). The multivariable analysis confirms that active smoking is an independent negative factor on survival (51% increase in the risk of death) after adjustment for gender, heart or vascular disease, diabetes, high blood pressure, ECOG performance status, histology, site of metastases (brain, liver, adrenals, lungs and bones). Figure 1



Conclusion:
Smoking cessation, before the initiation of chemotherapy, is associated with a better overall survival in chemotherapy treated stage IV NSCLC patients, even in previously heavy smokers and after adjustments for comorbidities. This retrospective analysis demonstrates the possible magnitude of the effect of smoking cessation on treatment efficacy with a potential gain of 6 months in median overall survival. Efforts to encourage smoking cessation are likely beneficial even among this population of patients.

Abstract not provided

Background:
Cigarette smoking is responsible for 85% of all lung cancers and about 1/3rd of all cancer deaths. Quitting smoking reduces the risk of getting lung cancer and other serious health problems. In 2012, the Joint Commission (JC) which sets quality standards for hospitals in the United States recommended that all current smokers identified upon hospitalization receive tobacco cessation services as an inpatient and be followed up after hospital discharge. However, few hospitals implement JC standards due to extra costs, the voluntary nature of the standards, and the lack of evidence demonstrating financial benefits to the hospital and insurers. In 2014, the Medical University of South Carolina (MUSC), a major tertiary care hospital in South Carolina, implemented an automated in-hospital smoking cessation program using interactive voice recognition (IVR) technology to follow-up with patients after discharge consistent with JC standards. This study reports on the results of the program over the first 12 months of operation between February 17, 2014 and January 31, 2015.

Methods:
Descriptive statistics are used to report on the number of patients screened, number of tobacco using patients seen by a bedside tobacco counselor while hospitalized, the number of tobacco using patients followed-up 3, 14, and 30 days after discharge, and the rate of unplanned hospital readmissions within a month of discharge.

Results:
A total of 30,846 patients aged 18 and older were screened for tobacco on hospital admission and 18% were identified current smokers. Of the 5,546 identified smokers, 2008 (36%) were approached by a single bedside counselor while hospitalized; 29% were unavailable for counseling for various reasons (e.g., discharged, too sick, not in room, deceased), 11% refused counseling, and 3% reported to the bedside counselor that they were non-tobacco users. A total of 4,197 tobacco using patients were enrolled into the automated telephone follow-up to assess smoking status and offer triage to the state quitline for those who wanted help. A total of 1,378 (33%) responded to at least one of the follow-up calls by one month, with 31% reporting that they were not smoking (10% classified as not smoking if non-responders are counted as smoking). The one month nonsmoking rate was 44% (19% based on intent to treat) in those seen by the bedside counselor compared to 24% (7% based on intent to treat) in those merely followed by phone. Unplanned 30-day hospital readmission rates were 9.1% for patients seen by the bedside counselor as compared with 15.7% for patients who did not receive bedside counseling based on the first 6 months of the program.

Conclusion:
An opt-out inpatient tobacco cessation service is feasible, can reduce relapse back to using tobacco after hospital discharge, and may reduce unplanned hospital readmissions.

Background:
Smoking cessation (SC) has rarely been recommended by oncologists in Ontario’s cancer centres. Many believe it is too late to matter or perceive that patients will not be receptive to SC. However, a growing body of literature has identified substantial health benefits from SC in cancer patients including improved general health, improved all-cause and cancer-specific mortality, reduced toxicity, greater response to treatment and decreased risk of disease recurrence and second primaries. Based on this evidence, Cancer Care Ontario (CCO) undertook an initiative to support SC for new ambulatory cancer patients in its Regional Cancer Programs (RCPs) in 2013.

Methods:
A steering committee of experts recommended a framework for SC in 2012 based on the Ottawa Model for Smoking Cessation. The CCO executive leadership and Regional Vice-Presidents supported the initiative which was then piloted in all 14 health regions in Ontario in 2014. Regional SC “champions” participated in monthly web meetings, data calls and in-person meetings led by a secretariat at CCO. Presentations on the health benefits of SC were made to physicians and other health care providers (HCPs) at regional cancer treatment centres and through the Ontario Telehealth Network. Presentations emphasized short, repeated oncologist scripts on the benefits of SC with referral to other HCPs for in-depth SC advice. New ambulatory cancer patients are screened, advised and referred to internal or external SC services dependent on regional resources. A minimum data set of standardized performance metrics is captured by CCO with patient-level data aggregated at the RCP level, presented as a provincial average, and reviewed with the RCPs in quarterly performance management sessions.

Results:
During Q1-Q3 of the 2014/15 fiscal year, 52.9% of all new ambulatory cancer cases were screened for smoking status. Of those screened, 21.3% were current or recent (within the last 6 months) tobacco users. Approximately three-quarters of these individuals were advised of the benefits of SC; a referral for cessation services was recommended in nearly 50%; of these patients, 66.7% accepted the referral to SC services. Of those accepting a referral, 50.4% chose referrals internal to the cancer treatment facility, 32.3% chose external referrals and the remainder (17.2%) used a combination of both referral resources. As part of this initiative a standardized cancer patient resource on SC in a print-ready format has been recently developed in both French and English and will be adapted for Ontario’s Aboriginal population.

Conclusion:
CCO’s centralized yet collaborative approach has led to province-wide implementation of a standardized intervention in a relatively short timeframe with limited financial resources. Ongoing barriers to implementation and sustainability experienced by RCPs include financial constraint, limited SC training resources, reluctant physician buy-in, strained staff and system capacity, and suboptimal inter-departmental communication. Nonetheless, there has been substantial progress. Framing SC as a quality of care issue has been critical to the success to date. Sustainability of the initiative will be dependent on continued committed leadership, buy-in from front-line staff, funding for dedicated SC counselors and other resources, and evidence of program cost-effectiveness.

Background:
In the 1990s Poland was among countries with the highest tobacco exposure and catastrophically high lung cancer mortality. Within the past two decades this situation has dramatically improved as a result of comprehensive national tobacco-control programs. We present the current tobacco exposure and

Methods:
Data on trends in cigarette consumption, smoking rates and lung cancer mortality were analyzed using the per capita sale of manufactured cigarettes, results of nation-wide questionnaire surveys conducted in adult (15+) population, and standardized mortality rates from lung cancer, respectively.

Results:
Between 1995 and 2013 annual cigarette sales in Poland decreased from 101 billion to 47 billion. The proportion of smokers among men dropped from 65% in 1980 to 28% in 2013, and among women from 32% to 18%, respectively. If this trend continues, the cigarette consumption per capita in Poland in 2040 will fall to the level of the 1920s. The age-standardized mortality rates per 100,000 from lung cancer in men declined from 71.1 in 1990 to 56.2 in 2010. The pattern of changes in lung cancer mortality among young Polish men became similar to that observed two decades earlier in the Unites States (Figure). However, Poland is still facing several challenges. Between 2003 and 2012 tobacco production in Poland increased by 90%, of which around two-thirds is exported. There is a persistently high proportion of smoking women, with almost a gender parity in the 35-44 age bracket (34% and 32% in women and men, respectively). Polish middle-aged women belong to the most common smokers in the European Union. The mortality rates from lung cancer among women are still on the rise. Since 2010 lung cancer has become the leading cause of death among women in Poland. Today, differences in smoking rates and lung cancer mortality are mainly generated by education and financial status, and not by gender. Figure 1



Conclusion:
There is an apparent need for further tobacco control efforts in Poland, including enforcement of the effective legislative measures (pictorial health warnings, plain cigarette packages, banning the sale of aromatic and ‘slim’ cigarettes) and implementation of tailored population-based preventive programs for women and socially unprivileged populations.

Abstract not provided

Background:
Newly detected nodules after baseline screen are common findings in low-dose computed tomography (LDCT) lung cancer screening, and may complicate management. So far little research focused specifically on nodules newly detected at incidence screening rounds. These nodules develop within a known time-frame and are expected to be fast-growing and potentially malignant. Even so, the majority are benign. The aim of this study was to compare volume and predicted growth rate of benign and malignant new solid nodules detected in the incidence screening rounds of the Dutch-Belgian Randomized Lung Cancer Screening Trial (NELSON).

Methods:
The NELSON trial was approved by the Dutch Ministry of Health. All participants gave written informed consent. In total, 7,557 individuals underwent baseline LDCT screening. After the baseline screening, incidence screening rounds took place after 1, 3 and 5.5 years. This study included participants with solid non-calcified nodules, newly detected after baseline and also in retrospect not present on any previous screening. Nodule volume was obtained semi-automatically by Lungcare software (Siemens, Erlangen, Germany). The growth rate at first detection was estimated by calculating the slowest predicted volume-doubling time (pVDT), according to the formula pVDT=[ln(2)*Δt]/[ln(V2/V1)], using the study’s detection limit of 15mm[3] (V1), the volume of the new nodule at first detection (V2), and the time interval between current and last screen (Δt [days]). The pVDT was calculated for nodules with a predicted volume increase of at least 25% (≥ 18.75mm[3]). Lung cancer diagnosis was based on histology. Benignity was based on histology or a stable size for at least two years. Mann-Whitney U testing was used to evaluate differences in volume and pVDT between malignant and benign nodules.

Results:
During the incidence screening rounds, 1,484 new solid nodules in 949 participants were detected of which 77 (5.2%) turned out to be malignant. At first detection, both the median volume of malignant (373mm[3], IQR 120-974mm[3]) and benign (44mm[3], interquartile-range [IQR] 22-122mm[3]) new nodules, as well as the median pVDT of malignant (144 days, IQR 116-213 days) and benign (288 days, IQR 153-566 days) new nodules differed significantly (P<0.001 for both). The calculated median pVDT of adenocarcinomas (183 days, IQR 138-299 days) and squamous-cell carcinomas (150 days, IQR 117-223 days) was similar to previously published volume doubling-times of fast-growing baseline cancers in the NELSON trial of the same histological type (196 days, IQR 135-250 days and 142 days, IQR 91-178 days, respectively).

Conclusion:
At incidence LDCT lung cancer screening, volume and pVDT can be used to differentiate between malignant and benign nature of newly detected solid nodules. The pVDT is a new measure that can assist in adjusting for time differences in screening intervals.

Background:
Although screening can reduce lung cancer (LC) mortality, the optimal screening strategy (e.g. numbers of screening rounds, screening interval) is unclear. The use of different screening intervals in the NELSON study is unique and makes it possible to investigate how the screening test performances (e.g. lung cancer detection rate, false positive rate) and characteristics of screen-detected lung cancers might change. This study describes the results of a fourth screening round that took place 2.5 years after the third round.

Methods:
The Dutch-Belgian randomized-controlled Lung Cancer Screening Trial (NELSON) aims to investigate whether low-dose CT screening would reduce LC mortality by at least 25% relative to no screening after ten years of follow-up. Therefore, screen group participants were screened four times: at baseline and year 1, 3, and 5.5. Screening test results were classified as negative, indeterminate, or positive based on nodule presence, volume (in case of new nodules) and volume doubling time (in case of previous existing nodules). Participants with an indeterminate test result underwent follow-up screening to classify their final screening test result as positive or negative. Participants with a positive scan result were referred to a pulmonologist for a diagnostic work-up. For this study, we included only participants who had attended all four screening rounds (n=5279). Epidemiological, radiological and clinical characteristics of lung cancers detected in the fourth round were compared with those of the lung cancers detected in the first three rounds. In addition, the risk for lung cancer detection in the fourth round (5.5 year risk) was quantified for subgroups.

Results:
In round four, 46 lung cancers were detected; 58.7% were diagnosed at stage I, 15.2% at stage II and 23.8% at stage III/IV. Adenocarcinomas were correlated with better cancer stage distribution, while small-cell carcinomas (SCLC) were associated with higher stage distribution (p=0.064). False positive rate after positive screening was 59.04% (62/105) and the overall false positive rate of the fourth round was 1.15% (62/5383). Relative to the results of the first three rounds, the LC detection rate was lower (0.80 vs 0.80-1.1) and LC was detected at a more advanced stage (23.8% vs 8.1%). In the fourth round more squamous-cell carcinomas (21.7% vs. 16.3%), SCLC (6.5% vs 3.8%) and bronchioloalveolar carcinomas (8.7% vs 5.3%) were detected. No large-cell carcinomas, large-cell neuroendocrine carcinomas or carcinoids were found in the fourth round. Screening results of the first three rounds led to formation of subgroups with significantly different probability of screening result in the fourth round: participants with previous exclusively negative results had a probability of 97.2% of negative screen compared to participants with ≥1 indeterminate or positive screen (94.6% and 87.1%) in the first three rounds. The risk of detecting LC in the fourth round also differed between these subgroups: exclusively negative results (<1.0%) and any time ≥1 indeterminate or positive result (1.5-1.7%).

Conclusion:
The LC detection rate after the third screening round was slightly lower and the stage distribution of screen-detected lung cancers in the fourth round was slightly less favorable. However, the differences seem limited.

Background:
The Danish Lung Cancer Screening Trial (DLCST) is a European randomized controlled trial comparing annual CT screening with no screening. Inclusion ran from 2004 to 2006, and participants have now been followed for 5 years since last CT screening (approximately 10 years since randomization). The American NLST showed 20% decrease in lung cancer mortality in the screening group, and DLCST is the first European trial to present comparable results regarding effect of screening on mortality, causes of death, lung cancer findings and risk stratification after sufficient follow up.

Methods:
4,104 participants aged 50-70 at time of inclusion and a minimum of 20 pack-years of smoking history were randomized to five annual low-dose CT scans or clinical follow up without CT scanning; thus, participants were younger and had fewer pack-years than participants from NLST. Screening was concluded in 2010. Follow up information regarding date and cause of death as well as lung cancer diagnosis, stage and histology was obtained from national registries, latest follow up date was April 7, 2015. . The effects of age, amount of smoking and COPD on lung cancer mortality in the two randomized groups were explored to evaluate possible effects of risk stratification and selection of high-risk individuals on effect of screening.

Results:
More cancers (100 vs. 53, p<0.001) were found in the screening group, in particular adenocarcinomas (58 vs. 18, p<0.001). Significantly more low-staged cancers (stage I+II: 54 vs. 10, p<0.001) and stage IIIa cancers (15 vs. 3, p=0.009) were found in the screening group. However, stage IV cancers were more frequent in the control group (23 vs. 32, p=0.278), and this was statistically significant for the highest-stage cancers (T4N3M1: 8 vs. 21, p=0.025). No differences in lung cancer mortality or all-cause mortality were observed between the two groups (Log Rank tests: p=0.898 and p=0.885, respectively). However, sub-group analyses including participants with higher age, presence of COPD, and more than 35 pack-years of smoking history showed significantly increased risk of death from lung cancer; the highest-risk group (with COPD and >35 pack-years) showed a 20% reduction in lung cancer mortality when screened. Though this result is not statistically significant due to small numbers, it does show compliance with the results from NLST.

Conclusion:
Although no statistically significant effects of 5 annual CT screening rounds on lung cancer mortality were observed in this small study, results indicate that focus on selection of high-risk individuals may be essential for the effect of CT lung cancer screening. We suggest that balancing benefits with harms—such as false positive findings and overdiagnosis— should bring focus to high-risk profiling of screening participants. Thus, the effects of age, amount of smoking, and COPD on the occurrence and mortality of lung cancer in the two randomization groups seems to indicate that limiting lung cancer screening to a higher-risk group improves the outcome of screening.

Abstract not provided

Background:
Lung-RADS published in 2014 by the American College of Radiology is based on literature review and expert opinion and uses nodule type, size, and growth to recommend nodule management adjusted to malignancy risk. The McWilliams model (N Engl J Med 2013;369:910-9) is a multivariate logistic regression model derived from the Pan-Canadian Early Detection of Lung Cancer Study and provides a nodule malignancy probability based on nodule size, type, morphology and subject characteristics. We compare the performance of both approaches on an independent data set.

Methods:
We selected 60 cancers from the Danish Lung Cancer Screening Trial as presented in the first scan they were visible, and randomly added 120 benign nodules from baseline scans, all from different participants. Data had been acquired using a low-dose (16x0.75mm, 120kVp, 40mAs) protocol, and 1mm section thickness reconstruction. For each nodule, the malignancy probability was calculated using McWilliams model 2b. Parameters were available from the screening database or scored by an expert radiologist. Completely calcified nodules and perifissural nodules were assigned a malignancy probability of 0, in accordance with model guidelines. All nodules were categorized into their Lung-RADS category based on nodule type and diameter. Perifissural nodules were treated as solid nodules, in accordance with Lung-RADS guidelines. For each Lung-RADS category cut-off sensitivity and specificity were calculated. Corresponding sensitivities and specificities using the McWilliams model were determined.

Results:
Defining Lung-RADS category 2/3/4A/4B and higher as a positive screening result, specificities to exclude lung malignancy were 21%/65%/86%/99% and vice versa sensitivities to predict malignancy were 100%/85%/58%/32%. At the same sensitivity levels as Lung-RADS, McWilliams model yielded overall higher specificities with 2%/86%/98%/100%, respectively (red arrows in Figure 1). Similarly, at the same specificities McWilliams’s model achieved higher sensitivities with 100%/95%/85%/48%, respectively (green arrows in Figure 1). Figure 1



Conclusion:
For every cut-off level of Lung-RADS, the McWilliams model yields superior specificity to reduce unnecessary work-up for benign nodules, and higher sensitivity to predict malignancy. The McWilliams model seems to be a better tool than Lung-RADS to provide a malignancy risk, thus reducing unnecessary work-up and helping radiologists determine which subgroup of nodules detected in a screening setting need more invasive work-up.

Background:
Although the National Lung Screening Trial (NLST) demonstrated that 3 annual low-dose CT (LDCT) screens reduced lung cancer specific and overall mortality at 6 years in a defined population of smokers, the decision to implement population-based screening is difficult in the absence of information on factors not evaluated in the NLST including frequency and duration of screening, characteristics of the “at risk” population, program cost and cost-effectiveness. The Canadian Partnership Against Cancer has developed a Cancer Risk Management Model for lung cancer (CRMM-LC) with a screening module informed by data from NLST that can evaluate these factors.

Methods:
CRMM-LC uses longitudinal microsimulation techniques that incorporate Canadian demographic characteristics, risk factors, cancer management approaches and outcomes, resource utilization and other economic factors to assess impacts on population health and costs to the Canadian healthcare system. Data sources include large national population surveys, cancer registries and census data. The diagnostic and therapeutic approaches and outcomes in CRMM-LC are based on input from Canadian lung cancer experts and survival information from medical literature. The simulated mortality reduction from LDCT screening using CRMM-LC is comparable to NLST. The model can projected incident cases, life years and quality adjusted life years over different time periods for populations defined by different age ranges and smoking histories and by screening duration and frequency (annual vs biennial). It can also inform individual provinces of the incremental resources (CT scans, invasive procedures) required for program implementation and project budget impact.

Results:
Based on NLST at risk criteria (55-74 yr old smokers of 30+ pack-years, the base case scenario), 1.4 million or 4% of Canadians would be candidates for LDCT screening in 2014. Annual screening over a 10 year period with a participation rate of 60% and 70% adherence would identify an additional 12,500 (4.7%) incident cases and result in 11,320 life-years saved (undiscounted). Biennial screening would identify 4,620 (1.6%) fewer cases and save 1,454 (12.8%) fewer life-years, but may be more cost-effective than annual screening. Scenarios modeling participation rates of 20, 40 and 80% (linear uptake over 10 years) yield incident cases that vary from 8,380 fewer for the lowest rate to 3,950 more for the highest with life years saved over 10 years ranging from 7,540 fewer to 3,310 more, respectively. The model projects 3,560 more cases would be detected if LDCT was introduced for younger (50 to 69 yr old), 30 pack-year smokers compared to the base case scenario and 1,760 more cases if the threshold number of pack years was decreased to 20 pack-years. The 10 year cumulative incremental cost in Canada of annual and biennial screening would be $1,107 and $709 million, respectively

Conclusion:
CRMM-LC, available at cancerview.ca/cancerriskmanagement, can be used by provincial analysts to estimate the impact of various scenarios on the impact of policy decisions concerning the scope of the LDCT screening program. In the current fiscally constrained healthcare environment, models that can assimilate diverse sources of information and extrapolate beyond clinical trial results can help inform decisions that healthcare administrators confront.

Background:
Screening for lung cancer according to age and smoking history alone could cost billions of dollars of public health expenditure due to the high incidence of potential participants. Risk-adapted lung cancer screening strategies such as participant selection (based on published risk prediction models such as the PLCOm2012 model) and malignancy risk based screening protocols may reduce program costs while improving outcomes among current and former smokers at risk of developing the disease. The Pan-Canadian Early Detection of Lung Cancer Study (PanCan) was designed with the objective of providing economic evidence for an affordable lung cancer-screening program in Canada.

Methods:
Data for 2537 screening participants in the PanCan study (median follow-up time of 4 years) and 25,914 eligible participants from the NLST-CXR arm were included in the analysis. There was adequate power and follow-up to inform the transition probabilities in model and provide the distribution to test all model parameters simultaneously in a probabilistic sensitivity analysis. The cost and health utility inputs are from patient-level trial data with defined ranges of certainty.

Results:
Our results show that risk selection using the PanCan risk prediction model could reduce the need to screen 21,022 (81%) of the NLST population if risk prediction were applied. If risk prediction were applied to Canadians who met the NLST criteria, 2 year program costs could be reduced by 400 million dollars and nearly half a million people could be spared the potential harms from screening that is not likely to result in a Cancer diagnosis. With the economic evidence from the PanCan and NLST trials, we report our initial cost-effectiveness results and will show, for the first time, a definitive description of the uncertainty surrounding our cost-effectiveness ratios.

Conclusion:
Using a model loaded with patient-level screening data has enabled us to predict the likelihood that risk-adapted screening will fall below most commonly referenced thresholds of acceptability for cancer interventions. The initial results and characterization of the parameters affecting cost-effectiveness will be presented. [*]on behalf of the PanCan study team The panCan study is sponsored by the Terry Fox Research Institute and the Canadian Partnership against Cancer, ARCC is funded by the CCSRI The authors thank the National Cancer Institute for access to NCI’s data collected by the National Lung Screening Trial. The statements contained herein are solely those of the authors and do not represent or imply concurrence or endorsement by NCI

Abstract not provided