Virtual Library
Start Your Search
M. Ladanyi
Moderator of
-
+
ED 02 - Molecular Testing Around the World (Genomics in Clinic (Timelines/Bioinformatics), Testing Platforms & Algorithms (NGS, Targeted Panels, FISH, IHC), Cost Considerations, Strategies for Identifying Rare Genomic Subsets in Clinical Trials) (ID 2)
- Event: WCLC 2015
- Type: Education Session
- Track: Biology, Pathology, and Molecular Testing
- Presentations: 4
- Moderators:M. Ladanyi, G. De Lima Lopes
- Coordinates: 9/07/2015, 14:15 - 15:45, Four Seasons Ballroom F1+F2
-
+
ED02.01 - North America (ID 1774)
14:20 - 14:40 | Author(s): V. Miller
- Abstract
- Presentation
Abstract not provided
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
ED02.02 - Asia (ID 1775)
14:40 - 15:00 | Author(s): J. Chung
- Abstract
- Presentation
Abstract:
Substantial progress has been made toward understanding the tumor biology of non-small cell lung cancer (NSCLC) during the last few years, and major discoveries in the molecular pathogenesis of lung cancer have led to successful applications of targeted therapeutic strategies. One representative of these successes is the subset of lung cancer patients with epidermal growth factor receptor (EGFR) mutations who have shown improved clinical response to tyrosine kinase inhibitors (TKIs).1 The prevalence of EGFR mutation is higher in the East Asian population than in Western populations. Asian NSCLC patients were reported to show a higher response rate and a longer survival to EGFR tyrosine kinase inhibitors (EGFR TKIs) as well as traditional chemotherapy. Therefore, genetic testing prior to treatment is becoming increasingly important and considered essential to select appropriate treatment strategies for NSCLC patients, especially in Asia. The exact mechanisms underlying these differences are not clear. However, approximately 45% of patients with NSCLC in the US are women whereas only 25% to 30% of patients with lung cancer are women in Eastern Asia. In addition, In the US, approximately 10% of patients with lung cancer are neversmokers (<100 lifetime cigarettes). In Asia, more than 30% of patients with lung cancer are neversmokers.2 Some international studies and global surveys have been conducted during the past few years to establish the current status of EGFR mutation testing and to establish the standard testing protocols.3-5EGFR mutation test is not yet available in many South East Asian medical institutions. In the medical facilities which do perform EGFR mutation test, the overall testing rate of newly diagnosed NSCLC is 31.8%, varying from 18.3% - 64.8%, the highest EGFR mutation testing rate was observed in Japan and the lowest in South East Asian Countries. Sex, smoking status and histological subtype are the main determining factors for EGFR mutation tests.5 However, the College of American Pathologists (CAP), International Association for the Study of Lung Cancer (IASLC), and Association for Molecular Pathology (AMP) guidelines recommended that patients with lung adenocarcinoma should not be excluded from testing on the basis of clinical characteristics that include ethnicity, smoking history, and sex. Factors associated with EGFR mutation status were country, sex, ethnicity, smoking status, smoking pack-years, disease stage and histology type. 4 In most countries, EGFR mutation rate and clinical pathologic factors are in line with previous reports in Asia, and the variations of EGFR mutation prevalence between countries are due to the selection of the tested populations. The majority of Asian institutions use PCR-based DNA direct sequencing methods to detect EGFR mutation. Other predictive biomarkers for EGFR TKI therapy are also available, including EGFR gene copy number, single-nucleotide polymorphisms of the EGFR gene, EGFR protein expression. 3 Next Generation Sequencing (NGS) and multiplex assays have made feasible the widespread adoption of molecular diagnostics for clinical use. According to our survey, the NGS is not available in clinics in most Asian medical institutions, and can be used for diagnosis of rare diseases and/or research. In China, sequencing based methods are the most commonly used, followed by the amplification mutation refractory system (ARMS).6 In Korea, the PNA clamp method is the most commonly used testing method, followed by direct sequencing methods.7 PCR-INVADER is the most commonly used test in Japan, followed by PNA-LNA PCR clamp.5 The materials for EGFR mutation analysis are usually from diagnostic samples, thus in most countries, small biopsy and cytology specimens are the most commonly used, followed by surgically resected tissues. Cytological specimens including smear slides and/or cell blocks have been shown to be suitable for EGFR mutation test.3, 5At present, the potential barriers to EGFR mutation testing in Asia include the cost, the number of laboratories capable of performing the test, communications between the clinicians and pathologists, and the predefined criteria for the type of patients who should be tested.3 The cost for EGFR mutation tests vary from U.S.$170 to 500. In most countries the costs are funded by the patients, but in a few countries are funded by pharmaceutical companies, while the insurance does not cover the cost of molecular testing in most Asian countries. Currently, National Comprehensive Cancer Network (NCCN)'s guidelines recommend EGFR-TKI as the first line treatment for patients with NSCLC harboring EGFR sensitizing mutations. Randomized first-line trials have demonstrated consistent improvement in tumor response rate and progression-free survival, but failed to prove overall survival benefit. These finding make TKI the second-line or third-line treatment options for NSCLC. Current data on treatment outcomes of second- and/or third-line EGFR therapy are still inconsistent.8 Patients treated with EGFR-TKI inevitably experience ac¬quired resistance by various molecular mechanisms. Many clinical trials are ongoing to explore the novel agents and strategies for better response and overcoming TKI resistance. In our questionnaire-based survey, four of seven Asia countries have ongoing clinical trials. The clinical trials include the first line and second line and maintance therapy using first generation and new generation EGFR TKIs. In 2013, more than 1000 studies with Chinese trials were registered on ClinicalTrials.gov and some trials used a local pharmaceutical company TKI, icotinib. Phase II studies of crizotinib in East Asian patients with ROS1-positive NSCLC are onging in China, Japan, South Korea and Taiwan. Anaplastic lymphoma kinase (ALK) rearrangement accounts for about 2–13% of unselected Asian patients with NSCLC, and occurs predominantly in younger individuals with adenocarcinoma who never smoked or light smokers (< 40 pack years). There is no strong evidence to suggest an ethnic difference of translocations among patients with NSCLC. The CAP/IASLC/AMP guideline recommended ALK FISH assay using FDA-approved specific companion test (Vysis ALK Break-Apart FISH Probe Kit, Abbott Molecular, Des Plaines, IL) for selecting patients for ALK tyrosine kinase inhibitor therapy. ALK immunohistochemistry (IHC) may be considered as a screening methodology to select specimens for ALK FISH testing. The ALK rearrangements have been shown to be 4.3% in men and 7.5% in women in Asian NSCLC by meta-analysis. Most Asia countries use FISH to detect ALK rearrangement, in Japan, reverse transcription–PCR (RT–PCR) is commonly used. In China, the Chinese Food and Drug Administration (CFDA) had approved VENTANA ALK IHC assay to aid the identification of patients for crizotinib treatment. The price of FISH detection range from US$415-800, and IHC range from US$14-220, most of which is funded by the patients.9 Recently, two additional oncogenes, RET and ROS1, were added to the list of driver oncogenes that are targetable with existing TKIs, and several clinical trials investigating the efficacy of such TKIs in Asia have been conducted. FISH and IHC are suitable for the diagnosis of ROS1 fusion, but some studies showed IHC is not suitable for the diagnosis of RET fusion.10 Over the past decades, we have witnessed rapid advances in molecular and cellular biology of lung cancer biology, and new data are upcoming which should facilitate personalized biomarker-based therapy in lung cancer, including characterization of driver mutations, genomic abnormalities and epigenetic changes. Individual centers should develop a multidisciplinary approach to integrate a molecular testing algorithm. Next generation sequencing should be able to resolve much of the complexity of molecular testing, especially in situations where there is only a small amount of tissue available. REFERENCES 1. Janku F, Stewart DJ, Kurzrock R. Targeted therapy in non-small-cell lung cancer--is it becoming a reality? Nat Rev Clin Oncol 2010;7:401-414. 2. Mok TS, Wu YL, Thongprasert S, et al. Gefitinib or carboplatin-paclitaxel in pulmonary adenocarcinoma. N Engl J Med 2009;361:947-957. 3. Salto-Tellez M, Tsao MS, Shih JY, et al. Clinical and testing protocols for the analysis of epidermal growth factor receptor mutations in East Asian patients with non-small cell lung cancer: a combined clinical-molecular pathological approach. J Thorac Oncol 2011;6:1663-1669. 4. Shi Y, Au JS, Thongprasert S, et al. A prospective, molecular epidemiology study of EGFR mutations in Asian patients with advanced non-small-cell lung cancer of adenocarcinoma histology (PIONEER). J Thorac Oncol 2014;9:154-162. 5. Yatabe Y, Kerr KM, Utomo A, et al. EGFR mutation testing practices within the Asia Pacific region: results of a multicenter diagnostic survey. J Thorac Oncol 2015;10:438-445. 6. Wang S, Wang Z. EGFR mutations in patients with non-small cell lung cancer from mainland China and their relationships with clinicopathological features: a meta-analysis. Int J Clin Exp Med 2014;7:1967-1978. 7. Shim HS, Chung JH, Kim L, et al. Guideline Recommendations for EGFR Mutation Testing in Lung Cancer: Proposal of the Korean Cardiopulmonary Pathology Study Group. Korean J Pathol 2013;47:100-106. 8. Sculier JP, Berghmans T, Meert AP. Advances in target therapy in lung cancer. Eur Respir Rev 2015;24:23-29. 9. Fan L, Feng Y, Wan H, et al. Clinicopathological and demographical characteristics of non-small cell lung cancer patients with ALK rearrangements: a systematic review and meta-analysis. PLoS One 2014;9:e100866. 10. Kohno T, Nakaoku T, Tsuta K, et al. Beyond ALK-RET, ROS1 and other oncogene fusions in lung cancer. Transl Lung Cancer Res 2015;4:156-164.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
ED02.03 - Europe (ID 1776)
15:00 - 15:20 | Author(s): C. Mascaux
- Abstract
- Presentation
Abstract:
Introduction Identification of molecular targets is now essential for the diagnosis, classification, selection and treatment monitoring of an increasing number of cancers. The analysis of these biomarkers must therefore be accessible to all patients, regardless of the healthcare facility where they are treated. Despite a decrease, lung cancer remains the leading cause of cancer-related deaths worldwide, often detected at an advanced stage with association with a poor prognosis. Recently, genetic alterations involved in adenocarcinomas have been discovered; some of these tumors harbor a driver mutation involving EGFR, KRAS, HER2, BRAF or PI3KCA gene or a rearrangement (ALK, ROS1, RET genes). Nearly 40% of NSCLC harbor one of those genetic abnormalities and several targeted therapies have been approved in USA and in Europe, such as erlotinib and gefitinib and crizotinib for NSCLC with EGFR mutation or ALK translocation, respectively. As many other targeted therapies are ongoing in lung cancer, molecular testing becomes a huge challenge worldwide, raising both financial and organizational issues.The French INCa molecular testing network: In 2006, the French National Cancer Institute (INCa) and the French Health Ministry have created a national network of 28 regional genetics platforms throughout the French territory, in order to offer molecular tests to all patients regardless of the institution where they are treated, i.e. university hospitals, cancer centers, hospital centers or private institutions, to enable that each innovative test could be rapidly implemented after new targeted therapies become available, and to guarantee the quality of the tests. The 28 regional platforms include a pathology laboratory in charge with the samples monitoring, and several laboratories with complementary expertise in molecular testing of hematological malignancies and solid tumors; as the tests are free of charge for the patients and the institutions, initial funds were given to all INCa genetics platforms to buy equipment (€4.7 million) and to hire non-medical personnel. The majority of these were technicians (58.32 FTE) and engineers (20.5 FTE); in addition, genetics platforms are financed on a basis of quarterly and annual activity reports to adjust budget and allocation. This initial funding was followed by the allocation of €4 million in annual funding for the centres and staff from the French Ministry of Health. The data sent in those reports are the number of tests performed each year, the number of patients undergoing tests, the percentage of patients found to have a molecular abnormality, the percentage of non-contributive results and the origin of requests. The INCa also set up a quality-assurance program with mandatory external quality evaluations, and publishes guidelines available on the Inca website. The markers studied are predictive markers that determine access to targeted therapy, markers guiding the diagnostic process, markers that contribute to establishing a diagnosis, prognostic markers guiding patient treatment strategy, and markers allowing the monitoring of residual diseases. Molecular genetics platforms do not have to perform all molecular tests: they must ensure that patients in their region have access to these tests via a referral platform. Tests concerning a large number of patients are carried out by all or almost all platforms (BCR-ABL quantification, KRAS and EGFR mutations, JAK2 mutations, MSI tests). For tests concerning a small number of patients, some platforms perform regional or national referral activity (ABL mutation screening in CML, cKIT and PDGFRA mutations in GIST, NMYC amplification in neuroblastomas, chromosomal abnormalities in sarcomas). Whereas the initial program included only EGFR and KRAS mutations’ detection in lung cancers and KRAS and BRAF mutations in colorectal cancers, a new program for detection of emerging biomarkers was set up in 2011; for lung non-squamous cell carcinoma patients at advanced stages those biomarkers were EGFR, K-RAS, HER2, BRAF and PI3KCA mutations and ALK translocations, and BRAF and KIT mutations in metastatic melanomas. In 2008, 1,269 EGFR activating mutation tests were performed, versus 2,667 in 2009, and 21,995 and 8,696 regarding EGFR mutation and ALK rearrangement, respectively in 2012. In 2013, 23,336 lung cancer samples were tested for EGFR mutations (10% were mutated), 18,861 for ALK rearrangement (3.5% rearranged), 22,9858 for KRAS mutations (27% mutated), 20,100 for BRAF mutation (2% mutated), 17,843 for HER2 mutation (0.7% mutated) and 17,375 for PI3KCA mutations (2.4% mutated).The German Network Genomic Medicine (NGM) Lung Cancer: The NGM is a health care provider network offering centralized high-quality next generation sequencing -based multiplex genotyping for lung cancer patients. Since NGS based genotyping is not reimbursed in Germany, the AOK Rheinland/Hamburg, one of the largest German public health insurances has contracted with the NGM for reimbursement of NGS-based multiplex genotyping of lung cancer in April 2014. In 2014, 4,500 lung cancer patients were gentotyped, representing nearly 10% of stage IV NSCLC patients in Germany.The Cancer Research UK (CRUK) Stratified medicine programme 1 and 2: There is no to date any national policy in UK for molecular testing for lung cancer patients, and a great variation exists regarding providers, funding and access; most of the time, the decision of referring for molecular testing depends on the clinician in reference to NICE clinical guidance. Nearly 7,300 UK patients were tested for EGFR mutations in 2010-2011 and depending on the units, ALK testing is performed either by IHC and /or FISH. In 2011, the Cancer Research UK (CRUK) Stratified Medicine Programme 1 and 2 has set-up a collaborative network of 26 hospitals and 8 CRUK Experimental Cancer Medicine Centres to provide genetic testing in lung, bowel, breast cancers and melanoma. The next plan for the NHS of England is to increase testing activity, to equitable access, to improve the quality assurance procedures and the cost values.References: 1. Collection Reports and summaries, collective volume edited by INCa, Boulogne-Billancourt, sept 2010 http://www.e-cancer.fr/Expertises-et-publications/Catalogue-des-publications/Molecular-genetic-testing-for-equal-access-to-targeted-therapies-in-France-in-2011 http://www.e-cancer.fr/Expertises-et-publications/Catalogue-des-publications/The-French-national-network-of-28-hospital-molecular-genetics-platforms-summary-of-the-activity-in-2009 http://www.e-cancer.fr/Expertises-et-publications/Catalogue-des-publications/Molecular-genetic-tests-for-access-to-targeted-therapies-in-France-in-2012 2. Nowak, F. et al. Tumour molecular profiling for deciding therapy—the French initiative. Nat. Rev. Clin. Oncol. 9, 479–486 (2012) 3. Nowak, F. et al. Europe Does It Better: Molecular Testing across a National Health Care System—The French Example; 2013 ASCO EDUCATIONAL BOOK | asco.org/edbook 4. Kostenko, A. et al. The network genomic medicine cost reimbursement model for implementation of comprehensive lung cancer genotyping in clinical routine. J Clin Oncol 33, 2015. ASCO Abstract e12556 5. CR UK Stratified Medicine Programme 1 and 2. http://www.cancerresearchuk.org/funding-for-researchers/how-we-deliver-research/our-research-partnerships/stratified-medicine-programme
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
ED02.04 - Central/South America (ID 1777)
15:20 - 15:40 | Author(s): M.L. Dalurzo
- Abstract
- Presentation
Abstract:
This presentation comprises data from Central and South America, as well as Mexico since all of us, as Latin American countries share similar characteristics. The countries included in this group are considered “developing countries” and are characterized by their racial, geographic, cultural, political and economic heterogeneity. In order to obtain data about the current situation in the region, I have sent a survey to the institutions that perform molecular tests in these countries for which I could get contact information. The survey has been sent to 34 laboratories in 12 countries. I tried to be as inclusive as possible, although in some cases it was rather difficult to get adequate contact information. My apologies to those who did not received the survey and would have liked to participate. Nineteen laboratories answered the survey ¹. Although not updated, I also added information from 5 other laboratories presented at LALCA 2014². Despite these results do not represent every country nor all molecular laboratories in the region, many common factors can be identified which allow for a relatively accurate analysis. The results show: Molecular tests are run by a small group of laboratories concentrated in the main cities of these countries. Most frequently, molecular testing is financed by pharmaceutical companies or private health care programs; however, in some cases the government, through the public healthcare system, supports the cost of the tests, and occasionally the patient pays for it. The pharmaceutical companies centralize molecular testing in a few laboratories in each country. Although frequency is generally low, some specimens are analyzed abroad, mainly in the USA. Some regional laboratories perform the tests for those countries that do not have adequate technology for molecular testing. The general opinion was that sending specimens to molecular center did not pose major complications, except in big countries where the geographic distance tends to delay the transport. Pharmaceutical companies provide the logistic structure to aid in the transfer of specimens, thus, accelerating the process. Specimen rejection rate can be divided into two groups: insufficient tissue or inadequate specimen quality by poor tissue preservation. The average rejection rate was 5 to 22%, more frequently around 15%. As for quantity, some institutions improved the amount of tissue obtained and specimen handling over time. When consulted on the possibility to perform molecular tests for treatment and/or research, the answer were: 2 laboratories only make test for research, 10 only run them for treatment purposes and 9 perform tests both for treatment and research. In most of the countries research is more frequently economically supported by the government than by other sources. When oncologists participate in clinical trials the tests are usually run abroad, mainly in the USA. Table 1 shows the available test platforms in the laboratories that participated in the survey and their access to quality control (QC) programs. For sequencing, all the laboratories began with Sanger sequencing, but many of them have changed to PCR-allele specific real-time platform. Some countries are introducing NGS. Most countries do not have local regulations for quality control of molecular tests. A half of the laboratories included in the survey have a kind of international QC, represented by participation in CAP or European QC programs or sending material to reference laboratories for interobserver concordance of results. Table1
* LALCA surveys information not updated Information on the total tests performed in the region is still incomplete and the number varies from country to country. In spite of this, the main reference laboratories are included in the survey and the data obtained reveals an insufficient number of tests related to the frequency of advanced lung cancer cases in the region. I did not include in this survey the test results but published Latin American data³¯⁴¯⁵ shown regional/country variability in the frequency of EGFR mutation and sometimes in ALK fusion test, probably related to genetic variability in the Latin American population. What are the challenges of molecular testing in Latin America? One of them is the quality and quantity of tissue available for molecular tests. In the region we still struggle against badly-fixed or inadequately processed specimens. In this field, probably, there is much education and interdisciplinary work to do yet. Reimbursement is another challenge. In most of the countries, pharmaceutical companies have financed so far the cost of molecular tests, but if this were not the case in the future when the need for many other tests arises, health care systems will have to bear testing and treatment costs. A careful evaluation will be required in each country to organize the most balanced use of the available resources. A particularly important challenge for the region is molecular testing quality certification. The access to international quality control programs is very expensive for the majority of the regional laboratories but quality control must be ensured. A group of us is trying to organize a stratified system that allows for a more affordable program to all laboratories. It is still a project in development. 1-Survey participants: Argentina: Esteban Mocetti: Hospital Italiano. Buenos Aires. Marina Gutierrez: Laboratorio Stamboulian. Buenos Aires. Erica Rojas Bilbao:Hospital Roffo. Buenos Aires. Guillermo Bramuglia: Argenomics. Fundacion Investigar. Buenos Aires. Valeria Denninghoff: Instituto CEMIC. Buenos Aires. Jorge Palazzi: IICT Labs. Rosario. Brasil: Fernando Soarez. Isabela Werneck da Cunha: AC Camargo Cancer Center. Sao Pablo. Fabio Tabora:Argos Lab / Messejana Hospital. Fortaleza. Chile: Cristina Fernández Ferradás:. Instituto Nacional del Tórax. Santiago de Chile. Antonio Piottante Becker: Clínica Las Condes. Santiago de Chile. Colombia: Andres Felipe Cardona. July Rodriguez: Foundation for Clinical and Applied Cancer Research Bogotá. Ruby E. Ríos Quintana-Roberto Jaramillo: Unidad de Diagnostico Hemto-Oncologico. Cali.Costa Rica: Luis Corrales Rodriguez: Centro de Investigación y Manejo del Cancer.(CIMCA y CCSS). San José. Mexico: Graciela Cruz Rico: Instituto Nacional de Cancerología. Distrito Federal. Erica Sagrario Peña Mirabal: Instituto de Enfermedades Respiratorias. Distrito Federal. Perú: Juan Carlos Gomez de La Torre Petrell: Laboratorios ROE. Lima. Uruguay: Alejandra Torres: Laboratorio Genia. Montevideo.Gonzalo Manrique, María Noel Zubillaga. Asociación Española. Montevideo. 2. LALCA 2014 surveys, not updated: Cintya Sternberg. INCA. Rio de Janeiro.Brasil, Vinicius Duval Da Silva Pontificia Universidade Catolica do Rio Grande do Sul. Brasil. Yumay Pires. Clinica Alemana. Santiago de Chile. Ana Margarita Baldión Elorza. Hospital Universitario Fundación Santafé de Bogota. Colombia. Nicolas Vivar Diaz. Hospital Carlos Andrade Marin. Quito Ecuador 3: Arrieta O, Cardona A, Martin C et al. Updated Frequency of EGFR and KRAS mutations in NSCLC in Latin America. The Latin-America Consortium for the Investigation of Lung Cancer (CLICaP) JTO 2015;10: 838-843 4: Bacchi C. et al. EGFR and KRAS mutations in Brazilian lung cancer patients. CLINICS 2012;67 (5):419-424 5: De Melo A et al. Mutational Profile and new IASLC/ATS/ERS classification provide additional prognostic information about lung ADC. A study of 125 patients from Brazil. Oncology 2015; Apr 1.(Epub ahead of print)Country Argentina Brazil Chile Colombia Costa Rica Ecuador Mexico Peru Uruguay Laboratories 6 2/2* 2/1* 2/1* 1 1* 2 1 2 EGFR 6 3 3 3 1 1 2 1 2 ALK 6 4 3 3 1 1 2 1 Other tests 5 3 2 3 1 2 1 2 Sanger Seq. 5 2 1 2 2 PCR allele specific-real time 4 2 2 2 1 1 2 1 1 NGS 3 1 1 FISH 4 3 3 2 1 1 2 1 IHQ 5 2 1 2 1 1 1 External QC 3 1 1 1 1 1 1
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
Author of
-
+
MINI 13 - Genetic Alterations and Testing (ID 120)
- Event: WCLC 2015
- Type: Mini Oral
- Track: Biology, Pathology, and Molecular Testing
- Presentations: 1
- Moderators:Y. Koh, R.K. Thomas
- Coordinates: 9/08/2015, 10:45 - 12:15, 205+207
-
+
MINI13.05 - Discussant for MINI13.01, MINI13.02, MINI13.03, MINI13.04 (ID 3338)
11:05 - 11:15 | Author(s): M. Ladanyi
- Abstract
- Presentation
Abstract not provided
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
MINI 22 - New Technology (ID 134)
- Event: WCLC 2015
- Type: Mini Oral
- Track: Biology, Pathology, and Molecular Testing
- Presentations: 1
-
+
MINI22.02 - Clinically Adoption of MSK-IMPACT, a Hybridization Capture-Based next Generation Sequencing Assay, for the Assessment of Lung Adenocarcinomas (ID 2881)
16:50 - 16:55 | Author(s): M. Ladanyi
- Abstract
- Presentation
Background:
Mutation analysis plays a central role in the management of lung adenocarcinomas (LUAD). The use of multiple single gene or mutation specific assays, broadly adopted in many laboratories to detect clinically relevant genomic alterations, often leads to delays if sequentially performed, tissue exhaustion, incomplete assessment and additional biopsy procedures. Comprehensive assays using massively parallel “next-generation” sequencing (NGS) offer a distinct advantage when addressing the increased testing needs of genotype-based therapeutic approaches. Here we describe our experience with a 410 gene, clinically validated, hybrid-capture-based NGS assay applied to testing of LUAD.
Methods:
Consecutive LUAD cases submitted for routine mutation analysis within a 1 year period were reviewed. Unstained slides of formalin fixed, paraffin embedded tissue were received for each case (range 15-20 slides/case). Corresponding H&E stained slides were reviewed and cell counts were performed in a subset of cases with limited material to establish minimal tissue requirements. Testing was performed by a laboratory-developed custom hybridization-capture based assay (MSK-IMPACT) targeting all exons and selected introns of 410 key cancer genes (J Mol Diagn 17:251-264, 2015). Barcoded libraries from tumor / normal pairs were captured and sequenced on an Illumina HiSeq 2500 and analyzed with a custom analysis pipeline.
Results:
A total of 469 specimens were received for comprehensive testing (98 cytology samples, 239 needle biopsies, 132 large biopsies/resections) of which 93% (436/469) were successfully tested. Thirty four cases (7%, 34/469) failed due to very low tumor content or low DNA yield. Cell counts for failed samples averaged 239 cells / slide (range 10-270) while all successfully tested had over 1,000 cells / slide each. Failure rate was similar for cytologies and biopsies. An average of 10 genomic alterations were detected per patient (range 1-96). The most frequently mutated genes were TP53, EGFR, KRAS, KEAP1 and STK11. Copy number gains of NKX2-1 and EGFR genes and CDKN2A loss were most common. EGFR mutations and ALK fusions were detected in 28% and 4% of cases, respectively. Among the 299 EGFR / ALK WT cases, MSK-IMPACT uncovered targetable genomic alterations that would have remained undetected through focused EGFR/ALK testing alone. These included fusions in RET (10) and ROS1 (13), mutations in ERBB2 (11) and BRAF (19) and amplifications in MET (12, unrelated to EGFR), MDM2 (26) and CDK4 (20) among others. The higher than expected rates of RET and ROS1 fusions are related to enrichment of previously tested cases known to be negative for other driver alterations.
Conclusion:
Comprehensive hybrid-capture based NGS assays such as MSK-IMPACT are an efficient testing strategy for LUAD across sample types. This upfront broad approach enables more optimal patient stratification for treatment by targeted therapeutics.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
MINI 27 - Biology and Other Issues in SCLC (ID 152)
- Event: WCLC 2015
- Type: Mini Oral
- Track: Small Cell Lung Cancer
- Presentations: 1
- Moderators:P.A. Bunn, Jr, J. Sage
- Coordinates: 9/09/2015, 16:45 - 18:15, 605+607
-
+
MINI27.11 - Comprehensive Mutation Analysis of Never-Smokers with Small Cell Lung Cancer (SCLC) (ID 3135)
17:45 - 17:50 | Author(s): M. Ladanyi
- Abstract
- Presentation
Background:
Although most patients with SCLC are current or former smokers, this disease has been reported in never-smokers. In our prospective genomic profiling of SCLC patients, we have identified four never-smokers. Here, we report next generation sequencing (NGS) results for these four SCLC patients and describe how they differ from those of smokers.
Methods:
We are evaluating pathologically confirmed SCLC tumors in patients undergoing treatment. Formalin-fixed, paraffin-embedded surgical resections, core biopsies, and fine needle aspirates are being evaluated using a targeted, hybrid capture-based, NGS assay, MSK-IMPACT, which identifies single nucleotide variants, indels, and copy number alterations in 341 cancer-associated genes. We determined never-smoking status prospectively: all smoked <100 cigarettes in their lifetime. Clinical data on stage [extensive (ES), limited (LS)], treatment, and response were collected.
Results:
Four never-smokers have been identified within the 50 patient samples that have undergone NGS evaluation thus far. The median age at diagnosis of the four never-smokers is 58 (range, 47-75); 50% are male; and one presented with LS-SCLC. None of these four patients developed SCLC as acquired resistance to EGFR tyrosine kinase inhibitors after treatment for EGFR-mutant lung cancers. The tumors from the four never-smokers displayed a median of 3 non-synonymous somatic mutations, while those from moderate (<20 pack years) and heavy (20+ pack years) smokers contained 4.5 and 8 mutations, respectively (P<0.05). None of the four never-smoker samples contained smoking associated G-to-T transversions (see Table). Inactivation of RB1 and TP53 occurred in 75% and 50% of the samples, respectively. Only patient 4 had platinum-refractory disease. The median survival of these patients was 20.7 months (range, 17 to 25).Sample Gene altered Alteration Present Protein Alteration Base Pair Alteration Patient 1 PHOX2B Missense Mutation P82L G-to-A NOTCH1 Frame-Shift Insertion P2485fs RB1 Splice Site R500_splice G-to-A TP53 Frame-Shift Deletion V218fs TP53 Frame-Shift Deletion V73fs TERT Amplification Patient 2 CBL Missense Mutation C401S G-to-C GNAS Missense Mutation M102V A-to-G MYCL Amplification Patient 3 TP53 Nonsense Mutation R342 G-to-A RB1 Frame-Shift Insertion T197fs CDKN2C Amplification MYCL Amplification Patient 4 RB1 Nonsense Mutation C666 ETV1 Amplification
Conclusion:
Using a targeted NGS assay, we have shown that the molecular characteristics differ between never-smokers and smokers, while the majority of the tumors demonstrate RB loss. Whole exome sequencing of the tumors from these never-smokers is underway. Ongoing comprehensive, multiplexed genotyping is needed to fully characterize the molecular diversity of SCLC in this unique population.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
MINI 38 - Biology and Prognosis (ID 167)
- Event: WCLC 2015
- Type: Mini Oral
- Track: Thymoma, Mesothelioma and Other Thoracic Malignancies
- Presentations: 1
- Moderators:R. Tsuchiya, M. Wynes
- Coordinates: 9/09/2015, 18:30 - 20:00, 702+704+706
-
+
MINI38.02 - BAP1 Inactivation in Mesothelioma Is Highly Prevalent (ID 657)
18:35 - 18:40 | Author(s): M. Ladanyi
- Abstract
- Presentation
Background:
Efforts to elucidate tumorigenic mutations in mesothelioma are essential to advance therapy. Prior efforts to characterize the molecular heterogeneity of this disease have been limited by sample condition and testing platforms. Herein, we describe efforts to prospectively test patients using next-generation sequencing with matched patient germline controls.
Methods:
Sequential mesothelioma patients were approached for consent to our IRB protocol NCT01775072 to perform MSK-IMPACT (Integrated Mutation Profiling of Actionable Cancer Targets), a comprehensive molecular profiling platform based on solution-phase exon capture and next generation sequencing to detect somatic genetic alterations in FFPE tumor specimens. MSK-IMPACT involves hybridization capture and deep sequencing of all protein-coding exons of 341 key cancer-associated genes, including all genes that are druggable by approved therapies or are targets of experimental therapies being investigated in clinical trials at MSKCC.
Results:
51 patients with mesothelioma underwent MSK-IMPACT testing (see Table 1). 12 samples had low tumor content. Among 39 samples with reliable results, BAP1 was the most common alteration (46%). Another 3 samples had changes also thought to inactivate BAP1 (2 samples had gene copy number changes just below the cutoff for whole gene deletions and 1 had an inversion of LIMD-BAP1 thought to inactivate BAP1), making the incidence of BAP1 alterations possibly as high as 56%. In 4 samples with sufficient tumor content, no alterations were identified. Table 1N=39 (%) Gender M/F 26/13 (67/33) Primary site of disease * Pleural * Peritoneal * Testicular 32 (82) 6 (15) 1 (3) # identified alteration, average 3 Alterations present in >6% * BAP1 * NF2 * CDKN2Ap16INK4A * SETD2 * CDKN2Ap14ARF * LATS1 * CREBBP * WT1 * CDKN2B * PI3KCA * PBRM1 * TP53 18 (46) 8 (21) 5 (13) 5 (13) 4 (10) 4 (10) 4 (10) 4 (10) 3 (8) 3 (8) 3 (8) 3 (8)
Conclusion:
Using MSK-IMPACT, BAP1 inactivation is the most common alteration. Other aberrations previously reported at high frequency were identified but albeit at lower frequencies (NF2 and p16, previously reported as 40% and 75% respectively). For multiple samples with deep coverage, no alterations were identified. The high incidence of BAP1 mutations in this systematic testing makes this pathway ideal for developing and testing targeted therapies.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
ORAL 03 - New Kinase Targets (ID 89)
- Event: WCLC 2015
- Type: Oral Session
- Track: Treatment of Advanced Diseases - NSCLC
- Presentations: 1
- Moderators:F. Blackhall, R. Juergens
- Coordinates: 9/07/2015, 10:45 - 12:15, Mile High Ballroom 4a-4f
-
+
ORAL03.07 - Response to MET Inhibitors in Stage IV Lung Adenocarcinoma Patients with Mutations That Cause MET Exon 14 Skipping (ID 2764)
11:50 - 12:01 | Author(s): M. Ladanyi
- Abstract
- Presentation
Background:
Mutations in the MET exon 14 RNA splice acceptor and donor sites, which lead to exon skipping, deletion of the juxtamembrane domain, and loss of Cbl E3-ligase binding to the resultant aberrant MET protein, were previously reported to be oncogenic in preclinical models (Kong-Beltran, Cancer Res 2006). These mutations occur in 4% of lung adenocarcinomas but have not been clinically assessed (TCGA 2014). We now report responses to the MET inhibitors crizotinib and cabozantinib in patients with stage IV lung adenocarcinomas harboring mutations leading to MET exon 14 skipping.
Methods:
Patients with stage IV lung adenocarcinomas harboring MET exon 14 splice site mutations (N=6) or a mutation deleting Y1003 in exon 14 (N=1) were identified through a clinical assay based on hybrid capture/next-generation sequencing of 341 oncogenes and tumor suppressors (MSK-IMPACT). MET IHC was performed on archival FFPE tissue. RNA skipping was confirmed by NanoString. Radiographic response to MET inhibition was assessed using RECIST 1.1 and PERCIST criteria.
Results:
Clinicopathologic data for those treated (N=4) are in the table below:
To date, 3 patients have been treated with off-label crizotinib and 1 with cabozantinib (NCT01639508). Three of four patients (75%) developed a PR to treatment. The remaining patient had SD by RECIST, with PET imaging demonstrating a complete PERCIST response to treatment.ID Age Sex Smoking status (pack years) MET exon 14 variant MET therapy Response MET IHC (H-score) 1 65 M C (20) MET p.V1001_F1007del (c.3001_3021delGTAGACTACCGAGCTACTTTT) crizotinib (3rd line) PR (-31%) NA 2 80 M F (20) MET c.3024_3028delAGAAGGTATATT crizotinib (3rd line) PR (-30%) 300 3 90 F N MET c.3028G>C crizotinib (3rd line) PR (-47%) NA 4 80 F N MET c.3028G>C cabozantinib (3rd line) SD (0%), CR (PERCIST) 300
Conclusion:
MET exon 14 skipping is a novel oncogenic target that predicts for response to MET inhibitors. This appears to be a substantially better predictor of response than either protein expression or gene amplification. Patients with these splice site mutations should be treated on a clinical trial of a MET inhibitor. For those without access to a trial, use of off-label crizotinib should be considered.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
