Virtual Library
Start Your Search
A. Drilon
Author of
-
+
MINI 16 - EGFR Mutant Lung Cancer 2 (ID 130)
- Event: WCLC 2015
- Type: Mini Oral
- Track: Treatment of Advanced Diseases - NSCLC
- Presentations: 1
- Moderators:G.J. Riely, M.C. Garassino
- Coordinates: 9/08/2015, 16:45 - 18:15, Four Seasons Ballroom F3+F4
-
+
MINI16.14 - A Phase 1 Study of Erlotinib and Ruxolitinib in Patients with EGFR-Mutant Lung Cancers and Acquired Resistance to Erlotinib Therapy (ID 2818)
18:00 - 18:05 | Author(s): A. Drilon
- Abstract
- Presentation
Background:
Patients with EGFR-mutant lung cancers treated with EGFR tyrosine kinase inhibitors (TKI) develop clinical resistance, often associated with acquisition of EGFR T790M. Upregulation of JAK/STAT signaling is involved in resistance to EGFR TKIs and JAK inhibition is a proposed treatment strategy in the setting of acquired resistance by restoring sensitivity to erlotinib. Ruxolitinib is an FDA-approved oral JAK1/2 inhibitor given at 20mg twice daily for hematologic malignancies with a largely non-overlapping toxicity profile with erlotinib.
Methods:
We evaluated the toxicity and efficacy of once daily oral erlotinib and twice daily oral ruxolitinib in patients with EGFR-mutant lung cancers and acquired resistance to erlotinib therapy (NCT02155465). Using a 3+3 dose escalation, we assessed escalating doses of ruxolitinib (10mg BID, 15mg BID, 20mg BID) with erlotinib 150mg daily for 21 day cycles. Response was evaluated by RECIST 1.1. Tissue and peripheral blood samples were obtained; exosomes will be extracted from peripheral blood and molecular and proteomic analyses will be performed.
Results:
From May 2014 to February 2015, 12 patients (pts) were enrolled. Median age: 60; Women: 7 (58%); never-smokers: 6 (50%); EGFR L858R=4 (33%) and Exon 19 deletion=8 (67%). Two of twelve (17%) were EGFR T790M positive at rebiopsy at the time of acquired resistance. Of 12 pts treated, 3 received ruxolitinib 10mg BID, 3 received 15mg bid and 6 received 20mg BID with erlotinib 150mg daily. No dose limiting toxicities were seen. The recommended phase 2 dose is ruxolitinib 20mg BID with 150mg erlotinib daily. Treatment-related AEs were all grade 1-3. The most frequent treatment related clinical adverse events (all grade 1-3) were anemia (25%), diarrhea (25%), rash (25%), pain (17%), fatigue (8%), and pneumonitis (8%). The most frequent treatment-related laboratory adverse events (all grade 1-2) were anemia (33%), elevated ALT (17%), elevated AST (17%), and hyperbilirubinemia (8%). Of the 12 pts treated, 2 (17%) required a dose reduction of erlotinib for treatment emergent toxicities; both subjects were on lower doses of erlotinib than 150mg daily prior to study enrollment. There were no dose reductions of ruxolitinib. Of 12 evaluable patients, no partial responses were seen. The median-progression free survival is 3 months. Two patients remain on study. One patient has been on study for 10 months with ongoing stable disease. Nine patients (75%) came off study for progression, 1 (8%) for toxicity. One person discontinued treatment on study for grade 3 pneumonitis, possibly related to the combination of erlotinib and ruxolitinib. The symptoms resolved with discontinuation of erlotinib and ruxolitinib.
Conclusion:
Combination erlotinib and ruxolitinib is well-tolerated. The phase 2 dose of ruxolitinib is 20mg BID in combination with erlotinib. There were no partial responses, but durable disease control was seen in some patients. The phase 2 study of erlotinib and ruxolitinib in this population is ongoing.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
MINI 22 - New Technology (ID 134)
- Event: WCLC 2015
- Type: Mini Oral
- Track: Biology, Pathology, and Molecular Testing
- Presentations: 1
-
+
MINI22.02 - Clinically Adoption of MSK-IMPACT, a Hybridization Capture-Based next Generation Sequencing Assay, for the Assessment of Lung Adenocarcinomas (ID 2881)
16:50 - 16:55 | Author(s): A. Drilon
- Abstract
- Presentation
Background:
Mutation analysis plays a central role in the management of lung adenocarcinomas (LUAD). The use of multiple single gene or mutation specific assays, broadly adopted in many laboratories to detect clinically relevant genomic alterations, often leads to delays if sequentially performed, tissue exhaustion, incomplete assessment and additional biopsy procedures. Comprehensive assays using massively parallel “next-generation” sequencing (NGS) offer a distinct advantage when addressing the increased testing needs of genotype-based therapeutic approaches. Here we describe our experience with a 410 gene, clinically validated, hybrid-capture-based NGS assay applied to testing of LUAD.
Methods:
Consecutive LUAD cases submitted for routine mutation analysis within a 1 year period were reviewed. Unstained slides of formalin fixed, paraffin embedded tissue were received for each case (range 15-20 slides/case). Corresponding H&E stained slides were reviewed and cell counts were performed in a subset of cases with limited material to establish minimal tissue requirements. Testing was performed by a laboratory-developed custom hybridization-capture based assay (MSK-IMPACT) targeting all exons and selected introns of 410 key cancer genes (J Mol Diagn 17:251-264, 2015). Barcoded libraries from tumor / normal pairs were captured and sequenced on an Illumina HiSeq 2500 and analyzed with a custom analysis pipeline.
Results:
A total of 469 specimens were received for comprehensive testing (98 cytology samples, 239 needle biopsies, 132 large biopsies/resections) of which 93% (436/469) were successfully tested. Thirty four cases (7%, 34/469) failed due to very low tumor content or low DNA yield. Cell counts for failed samples averaged 239 cells / slide (range 10-270) while all successfully tested had over 1,000 cells / slide each. Failure rate was similar for cytologies and biopsies. An average of 10 genomic alterations were detected per patient (range 1-96). The most frequently mutated genes were TP53, EGFR, KRAS, KEAP1 and STK11. Copy number gains of NKX2-1 and EGFR genes and CDKN2A loss were most common. EGFR mutations and ALK fusions were detected in 28% and 4% of cases, respectively. Among the 299 EGFR / ALK WT cases, MSK-IMPACT uncovered targetable genomic alterations that would have remained undetected through focused EGFR/ALK testing alone. These included fusions in RET (10) and ROS1 (13), mutations in ERBB2 (11) and BRAF (19) and amplifications in MET (12, unrelated to EGFR), MDM2 (26) and CDK4 (20) among others. The higher than expected rates of RET and ROS1 fusions are related to enrichment of previously tested cases known to be negative for other driver alterations.
Conclusion:
Comprehensive hybrid-capture based NGS assays such as MSK-IMPACT are an efficient testing strategy for LUAD across sample types. This upfront broad approach enables more optimal patient stratification for treatment by targeted therapeutics.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
MINI 30 - New Kinase Targets (ID 157)
- Event: WCLC 2015
- Type: Mini Oral
- Track: Treatment of Advanced Diseases - NSCLC
- Presentations: 1
- Moderators:K. Park, M. Villalona
- Coordinates: 9/09/2015, 18:30 - 20:00, Four Seasons Ballroom F3+F4
-
+
MINI30.09 - Clinical Response to Entrectinib in a Patient with NTRK1-Rearranged Non-Small Cell Lung Cancer (NSCLC) (ID 2913)
19:15 - 19:20 | Author(s): A. Drilon
- Abstract
- Presentation
Background:
Chromosomal rearrangements involving neurotrophic tyrosine kinase 1 (NTRK1) occur in less than 1% of NSCLCs. Cell-based assays have demonstrated that NTRK1 rearrangement leads to expression of an oncogenic TrkA fusion protein. While inhibition of TrkA in preclinical models reduces TrkA auto-phosphorylation and cell proliferation, the clinical activity of TrkA inhibitors in NSCLCs harboring an NTRK1 fusion is not known. Entrectinib (RXDX-101) is an orally available tyrosine kinase inhibitor of TrkA, TrkB, TrkC, ROS1, and ALK, with IC50 values for kinase inhibition ≤ 2 nM.
Methods:
We used an anchored multiplex polymerase chain reaction (AMP) assay to screen for NTRK1 rearrangements (Zheng et al., Nature Medicine 2014). Among over 663 NSCLC cases screened, we identified one positive case in which the 3’ end of SQSTM1 exon 6 was fused to the 5’ end of NTRK1 exon 10, leading to an SQSTM1-NTRK1 fusion transcript. We enrolled the patient onto the Phase 1 dose escalation study of entrectinib in adult patients with locally advanced or metastatic tumors (NCT02097810). The dose of entrectinib was 400 mg/m[2] (750 mg) once daily. We assessed safety of entrectinib and response to treatment using RECIST 1.1.
Results:
The patient is a 46 yo male with a 30 pack year smoking history who was first diagnosed with metastatic NSCLC in November 2013. Prior therapies included carboplatin/pemetrexed, pembrolizumab, docetaxel, and vinorelbine. At the time of study enrollment, the patient had an ECOG performance status of 2 and required supplemental oxygen at a rate of 3 liters per minute by nasal cannula. He reported significant pain and dyspnea due to widely metastatic disease, including a large left hilar mass narrowing the left upper lobe bronchus and obstructing the left lower lobe bronchus, extensive and palpable neck and chest lymphadenopathy, and a palpable expansile left chest wall mass. Staging head CT also revealed numerous (15 to 20) asymptomatic brain metastases measuring up to 1.7 cm that had not been previously treated. The patient was started on entrectinib and tolerated the study medication well, with one adverse event of grade 1 dysgeusia, which resolved after two weeks. Within three weeks of starting treatment, the patient reported resolution of dyspnea and pain, and improvement in energy and appetite. He no longer required supplemental oxygen and all sites of palpable disease had improved or resolved. At four weeks of treatment, restaging CT scans demonstrated a partial response by RECIST of -47%, with significant regression or resolution of lymphadenopathy, reduction in size of the chest wall mass, and marked reexpansion of the left lung. Restaging of the CNS by head CT demonstrated near complete resolution of previously visualized brain metastases.
Conclusion:
In a heavily pre-treated patient with NSCLC harboring an NTRK1 gene fusion, entrectinib therapy resulted in rapid clinical improvement and a radiologic partial response at 4 weeks with minimal toxicity. This preliminary report suggests that entrectinib may be an effective therapy for patients with NTRK1-rearranged NSCLC.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
ORAL 03 - New Kinase Targets (ID 89)
- Event: WCLC 2015
- Type: Oral Session
- Track: Treatment of Advanced Diseases - NSCLC
- Presentations: 2
- Moderators:F. Blackhall, R. Juergens
- Coordinates: 9/07/2015, 10:45 - 12:15, Mile High Ballroom 4a-4f
-
+
ORAL03.05 - Clinical Outcomes with Pemetrexed-Based Systemic Therapy in RET-Rearranged Lung Cancers (ID 2813)
11:28 - 11:39 | Author(s): A. Drilon
- Abstract
- Presentation
Background:
Previous series have shown that clinical benefit with pemetrexed-based systemic therapy can be durable in patients with ALK- and ROS1-rearranged lung cancers. The benefit of pemetrexed-based treatment in RET-rearranged lung cancers relative to other genomic subsets has not been explored.
Methods:
A retrospective review of records of patients treated at Memorial Sloan Kettering between 2007-2014 was conducted. Eligibility criteria: pathologically-confirmed advanced (stage IIIB/IV) non-small cell lung carcinoma, treatment with pemetrexed as monotherapy or in combination with other systemic agents, documented evidence of a rearrangement involving RET, ROS1, or ALK, or a KRAS mutation. Screening for these alterations was performed via break apart fluorescence in situ hybridization, multiplex mutation hotspot testing (Sequenom), or next-generation sequencing (MSK-IMPACT, Illumina HiSeq). Progression-free survival (PFS) and time to progression (TTP) were calculated using Kaplan-Meier estimates from the date of initiation of pemetrexed-containing therapy, and overall survival (OS) from diagnosis of metastatic disease. Overall response rate (ORR, RECIST v1.1), PFS, TTP, and OS were compared between RET-rearranged lung cancers and control groups (ALK- and ROS1-rearranged and KRAS-mutant lung cancers).
Results:
Data from 104 patients (RET-rearranged n=17, ROS1-rearranged n=10, ALK-rearranged n=36, KRAS-mutant n=41) were evaluated. As expected, median pack-year cigarette smoking history significantly differed between groups (p<0.001): RET 0 (0-48 range), ROS1 0 (0-12), ALK 0 (0-74), KRAS 38 (0-93). Features such as line of pemetrexed therapy (first vs other, p=0.1186), type of therapy (platinum combination, non-platinum combination, vs single-agent, p=0.1435), and need for dose reduction (p=0.9772) did not differ between groups. ORR, TTP, PFS, and OS in RET-rearranged lung cancers were not significantly different compared to ALK- and ROS1-rearranged lung cancers, and improved compared to KRAS-mutant lung cancers (Table 1). Table 1. Clinical Outcomes of Pemetrexed-Based TherapyRET ROS1 ALK KRAS p-value ORR 45% 78% 50% 26% 0.0242 Median TTP (months) NR (20-NR) 32 (14-NR) NR 7 (5-14) <0.001 ALK vs ROS1 vs RET (p=0.90); RET vs KRAS(p=0.009) Median PFS 20 (10-NR) 23 (14-NR) 24 (15-38) 6 (5-9) <0.001 ALK vs ROS1 vs RET (p=0.94); RET vs KRAS(p=0.002) Median OS NR (24-NR) NR (24- NR) 37 (30-63) 16 (13-29) <0.001 ALK vs ROS1 vs RET (p=0.43); RET vs KRAS(p=0.002)
Conclusion:
Clinical benefit with pemetrexed-based therapy in RET-rearranged lung cancers can be durable and is comparable to ALK- and ROS1-rearranged lung cancers. Outcomes in RET-, ROS1-, and ALK-rearranged lung cancers were improved compared to KRAS-mutant lung cancers. Mechanisms responsible for pemetrexed sensitivity in these subsets should continue to be explored. Driver-independent factors such as smoking history may contribute to clinical benefit.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
ORAL03.07 - Response to MET Inhibitors in Stage IV Lung Adenocarcinoma Patients with Mutations That Cause MET Exon 14 Skipping (ID 2764)
11:50 - 12:01 | Author(s): A. Drilon
- Abstract
- Presentation
Background:
Mutations in the MET exon 14 RNA splice acceptor and donor sites, which lead to exon skipping, deletion of the juxtamembrane domain, and loss of Cbl E3-ligase binding to the resultant aberrant MET protein, were previously reported to be oncogenic in preclinical models (Kong-Beltran, Cancer Res 2006). These mutations occur in 4% of lung adenocarcinomas but have not been clinically assessed (TCGA 2014). We now report responses to the MET inhibitors crizotinib and cabozantinib in patients with stage IV lung adenocarcinomas harboring mutations leading to MET exon 14 skipping.
Methods:
Patients with stage IV lung adenocarcinomas harboring MET exon 14 splice site mutations (N=6) or a mutation deleting Y1003 in exon 14 (N=1) were identified through a clinical assay based on hybrid capture/next-generation sequencing of 341 oncogenes and tumor suppressors (MSK-IMPACT). MET IHC was performed on archival FFPE tissue. RNA skipping was confirmed by NanoString. Radiographic response to MET inhibition was assessed using RECIST 1.1 and PERCIST criteria.
Results:
Clinicopathologic data for those treated (N=4) are in the table below:
To date, 3 patients have been treated with off-label crizotinib and 1 with cabozantinib (NCT01639508). Three of four patients (75%) developed a PR to treatment. The remaining patient had SD by RECIST, with PET imaging demonstrating a complete PERCIST response to treatment.ID Age Sex Smoking status (pack years) MET exon 14 variant MET therapy Response MET IHC (H-score) 1 65 M C (20) MET p.V1001_F1007del (c.3001_3021delGTAGACTACCGAGCTACTTTT) crizotinib (3rd line) PR (-31%) NA 2 80 M F (20) MET c.3024_3028delAGAAGGTATATT crizotinib (3rd line) PR (-30%) 300 3 90 F N MET c.3028G>C crizotinib (3rd line) PR (-47%) NA 4 80 F N MET c.3028G>C cabozantinib (3rd line) SD (0%), CR (PERCIST) 300
Conclusion:
MET exon 14 skipping is a novel oncogenic target that predicts for response to MET inhibitors. This appears to be a substantially better predictor of response than either protein expression or gene amplification. Patients with these splice site mutations should be treated on a clinical trial of a MET inhibitor. For those without access to a trial, use of off-label crizotinib should be considered.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
P3.01 - Poster Session/ Treatment of Advanced Diseases – NSCLC (ID 208)
- Event: WCLC 2015
- Type: Poster
- Track: Treatment of Advanced Diseases - NSCLC
- Presentations: 1
- Moderators:
- Coordinates: 9/09/2015, 09:30 - 17:00, Exhibit Hall (Hall B+C)
-
+
P3.01-075 - Phase 2 Trial of Bortezomib in KRAS G12D Mutant Lung Cancers (ID 2943)
09:30 - 09:30 | Author(s): A. Drilon
- Abstract
Background:
KRAS mutations are the most common oncogenic drivers in lung cancers without any approved targeted therapy. Preclinical evidence suggests that KRAS mutations are highly dependent on the NF-kB pathway. Bortezomib, a small molecule proteasome inhibitor, has been shown to downregulate the NF-kB pathway and lead to objective responses in patients with KRAS G12D in early phase clinical trials. In this single-institution, open label, phase II study we assessed the efficacy and safety of subcutaneous bortezomib in KRAS mutant lung cancers.
Methods:
Patients with advanced KRAS G12D mutant lung cancers were eligible. Bortezomib was administered at 1.3mg/m2/dose subcutaneously on days 1, 4, 8, and 11 of a 21 day cycle until disease progression or unacceptable toxicity. The primary objective was radiographic response rate (RECIST version 1.1). The secondary endpoints were progression free survival (PFS) and overall survival (OS) determined from the time of first bortezomib treatment. Simon two-stage minimax design was used (H0=10%, H1=30%, power=90%).
Results:
Sixteen patients with KRAS G12D mutant lung adenocarcinomas were treated on study: 44% women, 38% never smokers, 31% former smokers ≤15 pack years, and 69% with invasive mucinous adenocarcinomas. Patients received treatment for a median of 2 months (range 1-12months). One patient had a partial response with a 66% reduction in disease burden (6% observed rate, 95% CI 0.2 to 30.2%). Of the 6 patients (40%) with stable disease, 2 remained on study for over 5 months. The median PFS was 1 month (95% CI 1-6). The median OS was 13 months (95% CI 6-NA). The median OS from date of diagnosis of metastatic disease was 39 months (95% CI 35-NA). The most common treatment-related toxicities of any grade were fatigue (50%), diarrhea (38%), nausea (31%), and papulopustular rash (31%). Treatment-related peripheral neuropathy occurred in 25% of patients (3 patients with grade 1, 1 patient with grade 2).
Conclusion:
In patients with G12D KRAS mutant lung cancers, bortezomib was well tolerated and associated with modest anti-tumor activity and durable disease control in a small subset of patients. Further investigation into predictive biomarkers for the efficacy of bortezomib should be pursued. Without a clear biomarker, no further study of bortezomib in KRAS- mutant lung cancers is warranted.
