Virtual Library
Start Your Search
H. Yu
Author of
-
+
MINI 16 - EGFR Mutant Lung Cancer 2 (ID 130)
- Event: WCLC 2015
- Type: Mini Oral
- Track: Treatment of Advanced Diseases - NSCLC
- Presentations: 1
- Moderators:G.J. Riely, M.C. Garassino
- Coordinates: 9/08/2015, 16:45 - 18:15, Four Seasons Ballroom F3+F4
-
+
MINI16.14 - A Phase 1 Study of Erlotinib and Ruxolitinib in Patients with EGFR-Mutant Lung Cancers and Acquired Resistance to Erlotinib Therapy (ID 2818)
18:00 - 18:05 | Author(s): H. Yu
- Abstract
- Presentation
Background:
Patients with EGFR-mutant lung cancers treated with EGFR tyrosine kinase inhibitors (TKI) develop clinical resistance, often associated with acquisition of EGFR T790M. Upregulation of JAK/STAT signaling is involved in resistance to EGFR TKIs and JAK inhibition is a proposed treatment strategy in the setting of acquired resistance by restoring sensitivity to erlotinib. Ruxolitinib is an FDA-approved oral JAK1/2 inhibitor given at 20mg twice daily for hematologic malignancies with a largely non-overlapping toxicity profile with erlotinib.
Methods:
We evaluated the toxicity and efficacy of once daily oral erlotinib and twice daily oral ruxolitinib in patients with EGFR-mutant lung cancers and acquired resistance to erlotinib therapy (NCT02155465). Using a 3+3 dose escalation, we assessed escalating doses of ruxolitinib (10mg BID, 15mg BID, 20mg BID) with erlotinib 150mg daily for 21 day cycles. Response was evaluated by RECIST 1.1. Tissue and peripheral blood samples were obtained; exosomes will be extracted from peripheral blood and molecular and proteomic analyses will be performed.
Results:
From May 2014 to February 2015, 12 patients (pts) were enrolled. Median age: 60; Women: 7 (58%); never-smokers: 6 (50%); EGFR L858R=4 (33%) and Exon 19 deletion=8 (67%). Two of twelve (17%) were EGFR T790M positive at rebiopsy at the time of acquired resistance. Of 12 pts treated, 3 received ruxolitinib 10mg BID, 3 received 15mg bid and 6 received 20mg BID with erlotinib 150mg daily. No dose limiting toxicities were seen. The recommended phase 2 dose is ruxolitinib 20mg BID with 150mg erlotinib daily. Treatment-related AEs were all grade 1-3. The most frequent treatment related clinical adverse events (all grade 1-3) were anemia (25%), diarrhea (25%), rash (25%), pain (17%), fatigue (8%), and pneumonitis (8%). The most frequent treatment-related laboratory adverse events (all grade 1-2) were anemia (33%), elevated ALT (17%), elevated AST (17%), and hyperbilirubinemia (8%). Of the 12 pts treated, 2 (17%) required a dose reduction of erlotinib for treatment emergent toxicities; both subjects were on lower doses of erlotinib than 150mg daily prior to study enrollment. There were no dose reductions of ruxolitinib. Of 12 evaluable patients, no partial responses were seen. The median-progression free survival is 3 months. Two patients remain on study. One patient has been on study for 10 months with ongoing stable disease. Nine patients (75%) came off study for progression, 1 (8%) for toxicity. One person discontinued treatment on study for grade 3 pneumonitis, possibly related to the combination of erlotinib and ruxolitinib. The symptoms resolved with discontinuation of erlotinib and ruxolitinib.
Conclusion:
Combination erlotinib and ruxolitinib is well-tolerated. The phase 2 dose of ruxolitinib is 20mg BID in combination with erlotinib. There were no partial responses, but durable disease control was seen in some patients. The phase 2 study of erlotinib and ruxolitinib in this population is ongoing.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
MINI 22 - New Technology (ID 134)
- Event: WCLC 2015
- Type: Mini Oral
- Track: Biology, Pathology, and Molecular Testing
- Presentations: 1
-
+
MINI22.02 - Clinically Adoption of MSK-IMPACT, a Hybridization Capture-Based next Generation Sequencing Assay, for the Assessment of Lung Adenocarcinomas (ID 2881)
16:50 - 16:55 | Author(s): H. Yu
- Abstract
- Presentation
Background:
Mutation analysis plays a central role in the management of lung adenocarcinomas (LUAD). The use of multiple single gene or mutation specific assays, broadly adopted in many laboratories to detect clinically relevant genomic alterations, often leads to delays if sequentially performed, tissue exhaustion, incomplete assessment and additional biopsy procedures. Comprehensive assays using massively parallel “next-generation” sequencing (NGS) offer a distinct advantage when addressing the increased testing needs of genotype-based therapeutic approaches. Here we describe our experience with a 410 gene, clinically validated, hybrid-capture-based NGS assay applied to testing of LUAD.
Methods:
Consecutive LUAD cases submitted for routine mutation analysis within a 1 year period were reviewed. Unstained slides of formalin fixed, paraffin embedded tissue were received for each case (range 15-20 slides/case). Corresponding H&E stained slides were reviewed and cell counts were performed in a subset of cases with limited material to establish minimal tissue requirements. Testing was performed by a laboratory-developed custom hybridization-capture based assay (MSK-IMPACT) targeting all exons and selected introns of 410 key cancer genes (J Mol Diagn 17:251-264, 2015). Barcoded libraries from tumor / normal pairs were captured and sequenced on an Illumina HiSeq 2500 and analyzed with a custom analysis pipeline.
Results:
A total of 469 specimens were received for comprehensive testing (98 cytology samples, 239 needle biopsies, 132 large biopsies/resections) of which 93% (436/469) were successfully tested. Thirty four cases (7%, 34/469) failed due to very low tumor content or low DNA yield. Cell counts for failed samples averaged 239 cells / slide (range 10-270) while all successfully tested had over 1,000 cells / slide each. Failure rate was similar for cytologies and biopsies. An average of 10 genomic alterations were detected per patient (range 1-96). The most frequently mutated genes were TP53, EGFR, KRAS, KEAP1 and STK11. Copy number gains of NKX2-1 and EGFR genes and CDKN2A loss were most common. EGFR mutations and ALK fusions were detected in 28% and 4% of cases, respectively. Among the 299 EGFR / ALK WT cases, MSK-IMPACT uncovered targetable genomic alterations that would have remained undetected through focused EGFR/ALK testing alone. These included fusions in RET (10) and ROS1 (13), mutations in ERBB2 (11) and BRAF (19) and amplifications in MET (12, unrelated to EGFR), MDM2 (26) and CDK4 (20) among others. The higher than expected rates of RET and ROS1 fusions are related to enrichment of previously tested cases known to be negative for other driver alterations.
Conclusion:
Comprehensive hybrid-capture based NGS assays such as MSK-IMPACT are an efficient testing strategy for LUAD across sample types. This upfront broad approach enables more optimal patient stratification for treatment by targeted therapeutics.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
ORAL 03 - New Kinase Targets (ID 89)
- Event: WCLC 2015
- Type: Oral Session
- Track: Treatment of Advanced Diseases - NSCLC
- Presentations: 1
- Moderators:F. Blackhall, R. Juergens
- Coordinates: 9/07/2015, 10:45 - 12:15, Mile High Ballroom 4a-4f
-
+
ORAL03.07 - Response to MET Inhibitors in Stage IV Lung Adenocarcinoma Patients with Mutations That Cause MET Exon 14 Skipping (ID 2764)
11:50 - 12:01 | Author(s): H. Yu
- Abstract
- Presentation
Background:
Mutations in the MET exon 14 RNA splice acceptor and donor sites, which lead to exon skipping, deletion of the juxtamembrane domain, and loss of Cbl E3-ligase binding to the resultant aberrant MET protein, were previously reported to be oncogenic in preclinical models (Kong-Beltran, Cancer Res 2006). These mutations occur in 4% of lung adenocarcinomas but have not been clinically assessed (TCGA 2014). We now report responses to the MET inhibitors crizotinib and cabozantinib in patients with stage IV lung adenocarcinomas harboring mutations leading to MET exon 14 skipping.
Methods:
Patients with stage IV lung adenocarcinomas harboring MET exon 14 splice site mutations (N=6) or a mutation deleting Y1003 in exon 14 (N=1) were identified through a clinical assay based on hybrid capture/next-generation sequencing of 341 oncogenes and tumor suppressors (MSK-IMPACT). MET IHC was performed on archival FFPE tissue. RNA skipping was confirmed by NanoString. Radiographic response to MET inhibition was assessed using RECIST 1.1 and PERCIST criteria.
Results:
Clinicopathologic data for those treated (N=4) are in the table below:
To date, 3 patients have been treated with off-label crizotinib and 1 with cabozantinib (NCT01639508). Three of four patients (75%) developed a PR to treatment. The remaining patient had SD by RECIST, with PET imaging demonstrating a complete PERCIST response to treatment.ID Age Sex Smoking status (pack years) MET exon 14 variant MET therapy Response MET IHC (H-score) 1 65 M C (20) MET p.V1001_F1007del (c.3001_3021delGTAGACTACCGAGCTACTTTT) crizotinib (3rd line) PR (-31%) NA 2 80 M F (20) MET c.3024_3028delAGAAGGTATATT crizotinib (3rd line) PR (-30%) 300 3 90 F N MET c.3028G>C crizotinib (3rd line) PR (-47%) NA 4 80 F N MET c.3028G>C cabozantinib (3rd line) SD (0%), CR (PERCIST) 300
Conclusion:
MET exon 14 skipping is a novel oncogenic target that predicts for response to MET inhibitors. This appears to be a substantially better predictor of response than either protein expression or gene amplification. Patients with these splice site mutations should be treated on a clinical trial of a MET inhibitor. For those without access to a trial, use of off-label crizotinib should be considered.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
