Virtual Library
Start Your Search
M. Berger
Author of
-
+
MINI 22 - New Technology (ID 134)
- Event: WCLC 2015
- Type: Mini Oral
- Track: Biology, Pathology, and Molecular Testing
- Presentations: 1
-
+
MINI22.02 - Clinically Adoption of MSK-IMPACT, a Hybridization Capture-Based next Generation Sequencing Assay, for the Assessment of Lung Adenocarcinomas (ID 2881)
16:50 - 16:55 | Author(s): M. Berger
- Abstract
- Presentation
Background:
Mutation analysis plays a central role in the management of lung adenocarcinomas (LUAD). The use of multiple single gene or mutation specific assays, broadly adopted in many laboratories to detect clinically relevant genomic alterations, often leads to delays if sequentially performed, tissue exhaustion, incomplete assessment and additional biopsy procedures. Comprehensive assays using massively parallel “next-generation” sequencing (NGS) offer a distinct advantage when addressing the increased testing needs of genotype-based therapeutic approaches. Here we describe our experience with a 410 gene, clinically validated, hybrid-capture-based NGS assay applied to testing of LUAD.
Methods:
Consecutive LUAD cases submitted for routine mutation analysis within a 1 year period were reviewed. Unstained slides of formalin fixed, paraffin embedded tissue were received for each case (range 15-20 slides/case). Corresponding H&E stained slides were reviewed and cell counts were performed in a subset of cases with limited material to establish minimal tissue requirements. Testing was performed by a laboratory-developed custom hybridization-capture based assay (MSK-IMPACT) targeting all exons and selected introns of 410 key cancer genes (J Mol Diagn 17:251-264, 2015). Barcoded libraries from tumor / normal pairs were captured and sequenced on an Illumina HiSeq 2500 and analyzed with a custom analysis pipeline.
Results:
A total of 469 specimens were received for comprehensive testing (98 cytology samples, 239 needle biopsies, 132 large biopsies/resections) of which 93% (436/469) were successfully tested. Thirty four cases (7%, 34/469) failed due to very low tumor content or low DNA yield. Cell counts for failed samples averaged 239 cells / slide (range 10-270) while all successfully tested had over 1,000 cells / slide each. Failure rate was similar for cytologies and biopsies. An average of 10 genomic alterations were detected per patient (range 1-96). The most frequently mutated genes were TP53, EGFR, KRAS, KEAP1 and STK11. Copy number gains of NKX2-1 and EGFR genes and CDKN2A loss were most common. EGFR mutations and ALK fusions were detected in 28% and 4% of cases, respectively. Among the 299 EGFR / ALK WT cases, MSK-IMPACT uncovered targetable genomic alterations that would have remained undetected through focused EGFR/ALK testing alone. These included fusions in RET (10) and ROS1 (13), mutations in ERBB2 (11) and BRAF (19) and amplifications in MET (12, unrelated to EGFR), MDM2 (26) and CDK4 (20) among others. The higher than expected rates of RET and ROS1 fusions are related to enrichment of previously tested cases known to be negative for other driver alterations.
Conclusion:
Comprehensive hybrid-capture based NGS assays such as MSK-IMPACT are an efficient testing strategy for LUAD across sample types. This upfront broad approach enables more optimal patient stratification for treatment by targeted therapeutics.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
MINI 27 - Biology and Other Issues in SCLC (ID 152)
- Event: WCLC 2015
- Type: Mini Oral
- Track: Small Cell Lung Cancer
- Presentations: 1
- Moderators:P.A. Bunn, Jr, J. Sage
- Coordinates: 9/09/2015, 16:45 - 18:15, 605+607
-
+
MINI27.11 - Comprehensive Mutation Analysis of Never-Smokers with Small Cell Lung Cancer (SCLC) (ID 3135)
17:45 - 17:50 | Author(s): M. Berger
- Abstract
- Presentation
Background:
Although most patients with SCLC are current or former smokers, this disease has been reported in never-smokers. In our prospective genomic profiling of SCLC patients, we have identified four never-smokers. Here, we report next generation sequencing (NGS) results for these four SCLC patients and describe how they differ from those of smokers.
Methods:
We are evaluating pathologically confirmed SCLC tumors in patients undergoing treatment. Formalin-fixed, paraffin-embedded surgical resections, core biopsies, and fine needle aspirates are being evaluated using a targeted, hybrid capture-based, NGS assay, MSK-IMPACT, which identifies single nucleotide variants, indels, and copy number alterations in 341 cancer-associated genes. We determined never-smoking status prospectively: all smoked <100 cigarettes in their lifetime. Clinical data on stage [extensive (ES), limited (LS)], treatment, and response were collected.
Results:
Four never-smokers have been identified within the 50 patient samples that have undergone NGS evaluation thus far. The median age at diagnosis of the four never-smokers is 58 (range, 47-75); 50% are male; and one presented with LS-SCLC. None of these four patients developed SCLC as acquired resistance to EGFR tyrosine kinase inhibitors after treatment for EGFR-mutant lung cancers. The tumors from the four never-smokers displayed a median of 3 non-synonymous somatic mutations, while those from moderate (<20 pack years) and heavy (20+ pack years) smokers contained 4.5 and 8 mutations, respectively (P<0.05). None of the four never-smoker samples contained smoking associated G-to-T transversions (see Table). Inactivation of RB1 and TP53 occurred in 75% and 50% of the samples, respectively. Only patient 4 had platinum-refractory disease. The median survival of these patients was 20.7 months (range, 17 to 25).Sample Gene altered Alteration Present Protein Alteration Base Pair Alteration Patient 1 PHOX2B Missense Mutation P82L G-to-A NOTCH1 Frame-Shift Insertion P2485fs RB1 Splice Site R500_splice G-to-A TP53 Frame-Shift Deletion V218fs TP53 Frame-Shift Deletion V73fs TERT Amplification Patient 2 CBL Missense Mutation C401S G-to-C GNAS Missense Mutation M102V A-to-G MYCL Amplification Patient 3 TP53 Nonsense Mutation R342 G-to-A RB1 Frame-Shift Insertion T197fs CDKN2C Amplification MYCL Amplification Patient 4 RB1 Nonsense Mutation C666 ETV1 Amplification
Conclusion:
Using a targeted NGS assay, we have shown that the molecular characteristics differ between never-smokers and smokers, while the majority of the tumors demonstrate RB loss. Whole exome sequencing of the tumors from these never-smokers is underway. Ongoing comprehensive, multiplexed genotyping is needed to fully characterize the molecular diversity of SCLC in this unique population.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
ORAL 03 - New Kinase Targets (ID 89)
- Event: WCLC 2015
- Type: Oral Session
- Track: Treatment of Advanced Diseases - NSCLC
- Presentations: 1
- Moderators:F. Blackhall, R. Juergens
- Coordinates: 9/07/2015, 10:45 - 12:15, Mile High Ballroom 4a-4f
-
+
ORAL03.07 - Response to MET Inhibitors in Stage IV Lung Adenocarcinoma Patients with Mutations That Cause MET Exon 14 Skipping (ID 2764)
11:50 - 12:01 | Author(s): M. Berger
- Abstract
- Presentation
Background:
Mutations in the MET exon 14 RNA splice acceptor and donor sites, which lead to exon skipping, deletion of the juxtamembrane domain, and loss of Cbl E3-ligase binding to the resultant aberrant MET protein, were previously reported to be oncogenic in preclinical models (Kong-Beltran, Cancer Res 2006). These mutations occur in 4% of lung adenocarcinomas but have not been clinically assessed (TCGA 2014). We now report responses to the MET inhibitors crizotinib and cabozantinib in patients with stage IV lung adenocarcinomas harboring mutations leading to MET exon 14 skipping.
Methods:
Patients with stage IV lung adenocarcinomas harboring MET exon 14 splice site mutations (N=6) or a mutation deleting Y1003 in exon 14 (N=1) were identified through a clinical assay based on hybrid capture/next-generation sequencing of 341 oncogenes and tumor suppressors (MSK-IMPACT). MET IHC was performed on archival FFPE tissue. RNA skipping was confirmed by NanoString. Radiographic response to MET inhibition was assessed using RECIST 1.1 and PERCIST criteria.
Results:
Clinicopathologic data for those treated (N=4) are in the table below:
To date, 3 patients have been treated with off-label crizotinib and 1 with cabozantinib (NCT01639508). Three of four patients (75%) developed a PR to treatment. The remaining patient had SD by RECIST, with PET imaging demonstrating a complete PERCIST response to treatment.ID Age Sex Smoking status (pack years) MET exon 14 variant MET therapy Response MET IHC (H-score) 1 65 M C (20) MET p.V1001_F1007del (c.3001_3021delGTAGACTACCGAGCTACTTTT) crizotinib (3rd line) PR (-31%) NA 2 80 M F (20) MET c.3024_3028delAGAAGGTATATT crizotinib (3rd line) PR (-30%) 300 3 90 F N MET c.3028G>C crizotinib (3rd line) PR (-47%) NA 4 80 F N MET c.3028G>C cabozantinib (3rd line) SD (0%), CR (PERCIST) 300
Conclusion:
MET exon 14 skipping is a novel oncogenic target that predicts for response to MET inhibitors. This appears to be a substantially better predictor of response than either protein expression or gene amplification. Patients with these splice site mutations should be treated on a clinical trial of a MET inhibitor. For those without access to a trial, use of off-label crizotinib should be considered.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
P2.04 - Poster Session/ Biology, Pathology, and Molecular Testing (ID 234)
- Event: WCLC 2015
- Type: Poster
- Track: Biology, Pathology, and Molecular Testing
- Presentations: 1
- Moderators:
- Coordinates: 9/08/2015, 09:30 - 17:00, Exhibit Hall (Hall B+C)
-
+
P2.04-050 - Basaloid Squamous Cell Cancers Arising from the Lung: Next Generation Sequencing Reveals PTCH1 Mutations in the Hedgehog Pathway (ID 3211)
09:30 - 09:30 | Author(s): M. Berger
- Abstract
Background:
Basaloid squamous cell lung cancers are a defined variant of non-small cell lung cancers associated with a high mitotic count and rapid clinical progression. Due to its morphologic similarities with basal cell carcinoma of the skin, distinguishing between the two can be difficult. We sought to define the molecular characteristics of basaloid squamous cell cancers that were clinically defined as possible lung primaries in an effort to aid in the diagnosis of this disease.
Methods:
We reviewed a total of 179 patients who were diagnosed with squamous cell lung cancers and had undergone tumor next generation sequencing at Memorial Sloan Kettering. Through the MSK-Integrated Mutation Profiling for Actionable Cancer Targets (MSK-IMPACT), the illumina HiSeq platform was used to detect 341 potentially actionable genetic alterations, including single base substitutions, indels, copy number alterations and selected gene fusions. Data on clinicopathologic characteristics, smoking history were reviewed, and their mutational profile described.
Results:
A total of 6 of 179 (2%) patients with squamous cell lung cancers were found to have basaloid features. Of the 6 patients with basaloid features, 5 (83%) were men, 2 (33%) were never-smokers, 6 (100%) were white Caucasians, 3 (50%) had resected lung specimens, and 2 (33%) presented with stage IV disease. Three cases (50%) had protein patched homolog 1 (PTCH1) mutations in the hedgehog pathway (H652Y, V1057splice, V579fs), identical to those found in basal cell carcinoma of the skin. Two of these patients had a history of basal cell carcinoma of the skin, raising the possibility of metachronous metastatic basal cell carcinoma of the skin. One patient had no such history of basal cell skin cancer.
Conclusion:
Basaloid squamous cell cancers that appear to arise from the lung frequently harbor PTCH1 mutations. Metachronous metastatic basal cell carcinoma of the skin needs to be considered as a possibility in patients with a history of superficial skin lesions. Patients diagnosed with these basaloid cancers that harbor PTCH1 mutations, whether from skin or lung origin, may benefit from hedgehog pathway inhibitors such as vismodegib.
