Virtual Library
Start Your Search
C.M. Rudin
Moderator of
-
+
MS 07 - SCLC Biology & Models (ID 25)
- Event: WCLC 2015
- Type: Mini Symposium
- Track: Biology, Pathology, and Molecular Testing
- Presentations: 5
- Moderators:D. Carney, C.M. Rudin
- Coordinates: 9/07/2015, 14:15 - 15:45, Mile High Ballroom 4a-4f
-
+
MS07.01 - PDX Models (ID 1872)
14:20 - 14:35 | Author(s): C.M. Rudin
- Abstract
- Presentation
Abstract not provided
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
MS07.02 - GEM Models (p53/Rb) (ID 1873)
14:35 - 14:50 | Author(s): K. Sutherland
- Abstract
- Presentation
Abstract:
Small cell lung cancer (SCLC) is an aggressive neuroendocrine (NE) tumour associated with poor 5-year survival rates. Given the difficulties associated with obtaining human material, genetically engineered mouse models (GEMMs) for SCLC have emerged as powerful pre-clinical tools for translational research. Inactivation of the tumour suppressor genes TRP53 and RB1 is almost universally found in human SCLC. Based on this observation, the Berns Laboratory generated a mouse model of sporadic SCLC whereby p53 and Rb1 loss was restricted to lung epithelial cells by intra-tracheal instillation of an Adeno-Cre virus (Cre expression is under the control of a ubiquitous CMV promoter). These mice develop NE lung tumours with striking morphological and genomic similarities to SCLC observed in human patients[1]. This model allows us to address questions that would not be possible using patient samples or cancer cell lines alone. In my presentation, I will provide an overview on the GEMMs for SCLC currently available. I will also touch upon the emergence of new gene editing technologies, such as CRISPR-Cas9, and how these techniques can be used to further manipulate current models to address clinically relevant questions. Lung cancers exhibit a high level of intra-tumoral heterogeneity. The histopathology of individual tumour subtypes, suggests that these tumours have distinct cells-of-origin, but this has not been formally shown. I will present the work we carried out to address the cellular origins of lung cancer, with a focus on the research we performed using the GEMM of SCLC (p53[f/f];Rb1[f/f]). Briefly, we generated a series of recombinant adenoviruses that target Cre-recombinase expression selectively in Club (Ad5-CC10-Cre), alveolar type 2 (Ad5-SPC-Cre) and neuroendocrine (Ad5-CGRP-Cre) cells[2]. To address the cellular origins of SCLC, we infected p53[f/f];Rb1[f/f] mice with our cell type-restricted Adeno-Cre viruses, listed above. Results from these studies show that inactivation of p53 and Rb1 can efficiently transform neuroendocrine (CGRP-positive) and to a lesser extent, alveolar type 2 (SPC-positive) cells leading to SCLC. In contrast, CC10-expressing cells were largely resistant to transformation. The results clearly indicate that neuroendocrine cells serve as the predominant cell-of-origin of SCLC. Interestingly genome-sequencing studies have revealed genetic aberrations that overlap with squamous cell carcinomas in a subset of SCLCs. Does this reflect a common cellular origin? I will present some recent data we have generated to address this question. References 1. Meuwissen R, Linn SC, Linnoila RI, Zevenhoven J, Mooi WJ and Berns A. Induction of small cell lung cancer by somatic inactivation of both Trp53 and Rb1 in a conditional mouse model. Cancer Cell 2003 vol. 4(3) pp. 181-189. 2. Sutherland KD, Proost N, Brouns I, Adriaesen D, Song J-Y and Berns A. Cell of origin in small cell lung cancer: inactivation of Trp53 and Rb1 in distinct cell types of the adult mouse lung. Cancer Cell 2011 vol. 19(6) pp. 754-764.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
MS07.03 - Pre-Clinical Mouse Models of SCLC to Identify and Validate New Therapeutic Targets (ID 1874)
14:50 - 15:05 | Author(s): J. Lim, N. Jahchan, D. Yang, J. George, M. Peifer, R.K. Thomas, J. Sage
- Abstract
- Presentation
Abstract:
Small cell lung cancer (SCLC) is a neuroendocrine subtype of lung cancer characterized by a fast growth rate, extensive dissemination, and rapid resistance to chemotherapy. Survival rates are dismal and have not significantly improved in the past few decades. The group of Roman Thomas and Martin Peifer sequenced the genomes of over 100 human SCLC, which demonstrates universal inactivation of p53 and RB and identified inactivating mutations in NOTCH family genes in ~25% of tumors. Accordingly, we found that activation of Notch signaling in a pre-clinical SCLC mouse model dramatically reduces the number of tumors and extends the survival of the mutant mice. In addition to suppressing proliferation, active Notch inhibits neuroendocrine gene expression in SCLC cells. Thus, Notch plays a key tumor suppressive role in SCLC and strategies to re-activate Notch in SCLC tumors may be beneficial to patients (George, Lim, et al., in press). At the histological level, SCLC tumor cells are often viewed as homogeneous. These studies and previous studies (e.g. Calbo et al., Cancer Cell, 2011 – Berns lab) have identified several levels of intra-tumor heterogeneity in SCLC, which may contribute significantly to SCLC aggressive nature and resistance to therapy. We will also discuss the existence and the role of several subpopulations of SCLC tumor cells involved in the long-term propagation of this cancer type, the rapid acquisition of chemoresistance, and metastasis. A better understanding of the molecular underpinnings of these cellular heterogeneity may help identify novel therapeutic targets in SCLC.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
MS07.04 - From GEMs to ROCKs - An Assessment of In Vitro Models for the Study of SCLC (ID 1875)
15:05 - 15:20 | Author(s): A.F. Gazdar
- Abstract
- Presentation
Abstract:
Because SCLC tumors are seldom resected, in vitro models to study this “recalcitrant disease” are of crucial importance. The major strengths and limitations of the three basic preclinical model systems are summarized in Table 1. Table 1: Strengths and Limitations of Preclinical model systems for the study of SCLC
Tumor Cell Lines SCLC lines have been established since the early 1970s. A large series of cell lines was established by Drs. Gazdar, Desmond Carney and John Minna.[1]Most lines retained the cytological and NE cell features of SCLC tumors. We have confirmed that vast majority of the NCI series of lines have retained these features even after 4 decades in culture. Some of the lines, especially those established after prior therapy and which had amplification of a MYC family gene, had atypical morphology and lacked some of the NE cell program. These were termed variant SCLC cell lines.[2]They remain the major resource for most of the biology studies performed in SCLC.[3] Constitutional sources of DNA are available for some of the lines. A major shortcoming is lack of cell lines established from the putative precursor cell, the NE cells of the respiratory epithelium. While most TCLs grow as two dimensional adherent monolayers, SCLC cultures naturally grow as three dimensional floating aggregates or spheroids. Several recent reports have suggested that three dimensional in vitro growth more closely resembles the natural growth characteristics of patient tumors, and may be more representative of drug response.[4] While they are an estimated 150 SCLC TCLs established worldwide, recent reports have been scarce. Two recent developments offered innovative new approaches to the establishment of SCLC lines. The finding that the circulating tumor cell burden in SCLC cases were extremely high and could be used to establish PDXs[5]was promising and also suggested that the circulating cells could be used to establish new SCLC TCLs. Recently a method for the propagation of epithelial cells of non-malignant and malignant origin, termed “Conditionally Reprogrammed Cells” (CRC) was described. CRC cells have properties of epithelial stem cells.[6]This method was widely utilized to generate many new putative lung cancer TCLs, mainly of NSCLC origin. Our extensive characterization (led by Boning Gao and John Minna) of CRC cells from NSCLC specimens indicated robust growth of epithelial cells apparently free of fibroblast contamination. However, characterization of the cells indicated that they mostly had properties of stem cells derived from non-malignant cells, and were diploid and lacked mutations present in the corresponding tumors. These results suggest, at least for lung cancer specimens, that the CRC method preferentially grows the non malignant epithelial stem cell component present in all lung cancer resections. Patient Derived Xenografts (PDXs) PDX tumors are generated by direct transfer of human tumor fragments or cell isolates from patient tumors to immune-deficient mice (or other rodent species). At least during early serial passage, PDXs retain the genetic and morphological characteristics of the original human tumor, including histological features, gene expression profiles, copy number variations and chromosomal stability of PDX tumors.[7] Thus, PDXs have been proposed as an advanced preclinical tool for therapy testing in a number of tumor types including lung cancers.[8] Most PDXs are inoculated subcutaneously. Orthotopic models for SCLC may increase metastatic potential and relevance for chemotherapy evaluation.[9] Intracranial heterotransplantation of SCLC into the brain provides a model to study intracranial and leptomeningeal meatastases.[10] The mouse genome contains over 500,000 copies of integrated strains of mouse leukemia virus virus. Some strains are xenotropic and grow efficiently in human cells. Serial transplantation of PDXs, especially SCLC, is associated with a high frequency of xenotropic virus contamination,[11]which poses potential health risks and may influence genetic analyses. Genetically engineered mouse models (GEMMs) Berns developed the double knockout model (lacking p53 and Rb1 that closely recapitulated the histology and metastatic pattern of SCLC, but had a relatively long latent period.[12]Several triple knockout variants of the basic model have been developed, specifically to reduce the long latent period. However, these variations often have more complex histologies, reflecting the spectrum of high grade NE carcinoma of the lung. The resultant histological phenotypes were influenced by multiple factors. The lengthy latent time permitted observations of the preneoplastic and premalignant stages of SCLC development, which are seldom observed in human tumors because of the explosive growth of SCLC once it becomes invasive. The long latent period is caused by the development of secondary genetic changes required for tumor formation such as alterations of the PTEN and NFIB genes.[13]A recent review[12]concluded that GEMM models studied are representative for the entire spectrum of human high-grade NE carcinomas and are also useful for the study of multistage pathogenesis and the metastatic properties of these tumors. Summary The major In vitro models for SCLC each have their individual strengths and weaknesses. Each has to be carefully evaluated for its suitability for the proposed experimental approach. Despite their limitations, In vitro models remain the single most important source of knowledge about the non-clinical aspects of SCLC and will likely remain so into the foreseeable future. 1. Phelps RM, Johnson BE, Ihde DC, et al. NCI-Navy Medical Oncology Branch cell line data base. J Cell Biochem 1996;Suppl. 24:32-91. 2. Gazdar AF, Carney DN, Nau MM, et al. Characterization of variant subclasses of cell lines derived from small cell lung cancer having distinctive biochemical, morphological, and growth properties. Cancer Res 1985;45:2924-2930. 3. Gazdar AF, Girard L, Lockwood WW, et al. Lung cancer cell lines as tools for biomedical discovery and research. Journal of the National Cancer Institute 2010;102:1310-1321. 4. Breslin S, O'Driscoll L. Three-dimensional cell culture: the missing link in drug discovery. Drug Discov Today 2013;18:240-249. 5. Hodgkinson CL, Morrow CJ, Li Y, et al. Tumorigenicity and genetic profiling of circulating tumor cells in small-cell lung cancer. Nat Med 2014;20:897-903. 6. Liu X, Ory V, Chapman S, et al. ROCK inhibitor and feeder cells induce the conditional reprogramming of epithelial cells. The American journal of pathology 2012;180:599-607. 7. Rosfjord E, Lucas J, Li G, et al. Advances in patient-derived tumor xenografts: from target identification to predicting clinical response rates in oncology. Biochem Pharmacol 2014;91:135-143. 8. Moro M, Bertolini G, Tortoreto M, et al. Patient-derived xenografts of non small cell lung cancer: resurgence of an old model for investigation of modern concepts of tailored therapy and cancer stem cells. J Biomed Biotechnol 2012;2012:568567. 9. Isobe T, Onn A, Morgensztern D, et al. Evaluation of novel orthotopic nude mouse models for human small-cell lung cancer. J Thorac Oncol 2013;8:140-146. 10. Gazdar AF, Carney DN, Sims HL, et al. Heterotransplantation of small-cell carcinoma of the lung into nude mice: comparison of intracranial and subcutaneous routes. Int J Cancer 1981;28:777-783. 11. Zhang YA, Maitra A, Hsieh JT, et al. Frequent detection of infectious xenotropic murine leukemia virus (XMLV) in human cultures established from mouse xenografts. Cancer Biol Ther 2011;12:617-628. 12. Gazdar AF, Savage TK, Johnson JE, et al. The comparative pathology of genetically engineered mouse models for neuroendocrine carcinomas of the lung. J Thorac Oncol 2015;10:553-564. 13. McFadden DG, Papagiannakopoulos T, Taylor-Weiner A, et al. Genetic and clonal dissection of murine small cell lung carcinoma progression by genome sequencing. Cell 2014;156:1298-1311.Preclinical Model Strengths Limitations Tumor Cell lines (TCLs) Spheroidal growth, cytological appearances and neuroendocrine (NE) cell properties. May represent oligoclonal selection. Lacks stroma and vasculature. Patient-derived xenografts (PDXs) Histology and gene expression profile of tumors closely resemble human counterpart. Stroma and vasculature are of host mouse origin. Lacks intact immune system. Metastatic spread limited. Possible contamination with murine xenotropic virus. Genetically Engineered Mouse Models (GEMMs) Reproduces pathology of NE carcinomas and similar metastatic pattern. Only model for studying multistage pathogenesis Long latent time. Precise histology mixture variable.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
MS07.05 - Circulating Tumour Cells (ID 1876)
15:20 - 15:35 | Author(s): F. Blackhall, C. Dive
- Abstract
- Presentation
Abstract:
Circulating Tumour Cells Dr Fiona Blackhall and Professor Caroline Dive Progress in understanding the molecular biology of small cell lung cancer has undoubtedly been hampered by lack of tissue resources suitable for comprehensive systems biology analysis. Tissue quantities sufficient for molecular analysis are more commonly from surgical resections and open biopsies from patients with very limited stage disease and therefore not representative of the majority of SCLC patients. Serial biopsies are even rarer to obtain. As an alternative to tumour tissue, circulating tumour cells (CTCs) are highly prevalent and abundant in patients with SCLC. These surrogate biomarkers, increasingly referred to as ‘virtual’ or ‘liquid’ biopsies, may be more relevant to understanding the biology of this disease that is hallmarked by early and widespread haematogenous dissemination. In our own series (Hou et al. JCO 2012) blood samples from 97 treatment naive patients, 31 with limited stage (LS) and 66 with extensive stage (ES), were assessed for CTCs using the EpCam-based immunomagnetic detection method, CellSearch. CTCs were detectable in the majority (85%) of patients and abundant. The mean ± standard deviation for CTC number(#) in a 7.5ml blood sample was 1,589 ± 5,565 and median CTC# was 24 (range 0 – 44, 896). CTC# was significantly associated (higher) with ES, lactate dehydrogenase, presence of liver metastases and number of sites of metastases. In multivariate analysis, adjusting for these clinical associations, pretreatment CTC# and change in CTC# after one cycle of chemotherapy were independent prognostic factors. A statistically derived cut off of 50 CTCs demonstrated most significant discrimination in survival estimation. The overall survival was 5.4 months for patients with ≥ 50 CTCs/7.5 mL of blood compared with 11.5 months (P < .0001) for patients with less than 50 CTCs/7.5 mL of blood before chemotherapy (hazard ratio = 2.45; 95% CI, 1.39 to 4.30; P =0 .002). In addition to prognostic information CTCs are pharmacodynamic and amenable to biomarker assay development (protein expression, omic profiling, FISH etc). CTCs ex vivo are also tumourigenic. We have established a series of CTC derived xenografts (CDX) in immune compromised (IC) mice (Hodgkinson et al. Nat Med 2014). Of 6 initial patients whose CTCs were implanted in IC mice, 4 gave rise to tumours in less than 5 months. Implantation and CDX tumour formation was associated with higher CTC# (>400 CTCs / 7.5mls of blood). The immunohistochemical characteristics of the CDX tumours were consistent with SCLC morphology and neuroendocrine marker expression. Whole genome sequencing demonstrated that the tumours had mutations (e.g. TP53 and RB1) and copy number variation (e.g. loss of 3p and 13q) commonly observed in SCLC. Furthermore, the same genetic abnormalities as the CDX were present in single cells CTCs isolated from the corresponding patient. On exposure of the CDX to platinum and etoposide chemotherapy a remarkable correlation was observed for the tumour responses compared to the patients’ tumour responses and survival. For example the most chemoresistant CDX was established from CTCs of a patient who survived for only 0.9 months and who had chemorefractory disease, whereas the most chemosensitive CDX was obtained from a patient who responded to platinum/etoposide chemotherapy and who survived for 9.7 months. A CDX of intermediate chemosensitivity was derived from a patient who survived for 3.5 months. Once the CDX tumours are established they can be harvested for passage, frozen and resurrected. Ongoing work aims to establish serial CDX models from patients who have progressed after initial treatment for study of biology, particularly that of acquired chemoresistance, and for preclinical testing of novel therapeutics in treatment naïve and previously treated SCLC. There is also possibility to incorporate serial CTC analysis and CDX model generation into clinical trials as ‘co-clinical trials’ with interrogation of pharmacodynamic and putative predictive biomarkers in addition to discovering mechanisms of resistance to novel therapeutics. CTC analysis and CDX model generation are technically challenging and resource intensive, but essential tools to further develop if we are to end the impasse on a targeted therapy breakthrough for this disease. References Hou JM, Krebs MG, Lancashire L, Sloane R, Backen A, Swain RK, Priest LJ, Greystoke A, Zhou C, Morris K, Ward T, Blackhall FH, Dive C. Clinical significance and molecular characteristics of circulating tumor cells and circulating tumor microemboli in patients with small-cell lung cancer. J Clin Oncol. 2012 Feb 10;30(5):525-32. Hodgkinson CL, Morrow CJ, Li Y, Metcalf RL, Rothwell DG, Trapani F, Polanski R, Burt DJ, Simpson KL, Morris K, Pepper SD, Nonaka D, Greystoke A, Kelly P, Bola B, Krebs MG, Antonello J, Ayub M, Faulkner S, Priest L, Carter L, Tate C, Miller CJ, Blackhall F, Brady G, Dive C. Tumorigenicity and genetic profiling of circulating tumor cells in small-cell lung cancer. Nat Med. 2014 Aug;20(8):897-903.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
Author of
-
+
MINI 21 - Novel Targets (ID 133)
- Event: WCLC 2015
- Type: Mini Oral
- Track: Biology, Pathology, and Molecular Testing
- Presentations: 1
- Moderators:B.P. Levy, D.S. Tan
- Coordinates: 9/08/2015, 16:45 - 18:15, Mile High Ballroom 2a-3b
-
+
MINI21.12 - Identification of a First in Class TWIST1 Inhibitor with Activity in KRAS Mutant NSCLC (ID 1616)
17:50 - 17:55 | Author(s): C.M. Rudin
- Abstract
- Presentation
Background:
Although a large fraction of non-small cell lung cancers (NSCLC) are dependent on defined oncogenic driver mutations, little progress has been made in the treatment of patients with the most common driver mutation, mutant KRAS. We previously demonstrated that the basic helix-loop-helix transcription factor, Twist1 cooperates with mutant Kras to induce lung adenocarcinoma in mouse models, and that inhibition of Twist1 in murine models and KRAS mutant NSCLC cell lines led to oncogene-induced senescence (OIS) and in some cases, apoptosis. Therefore, targeting the TWIST1 pathway represents an exciting and novel therapeutic strategy which may have a significant clinical impact.
Methods:
We used gene expression profiles from KRAS mutant human NSCLC cell lines following shRNA-mediated TWIST1 knockdown to perform connectivity map (CMAP) analysis to identify pharmacologic inhibitors of TWIST1. Growth inhibition was determined through the colony formation and MTS assays. Apoptosis (cl-PARP, active anti-C3) and OIS (SA-β-Gal) was assessed. Genetic (shRNA) and pharmacologic inhibition of the TWIST1-E2A pathway was performed. Lung tumor burden as well as levels of TWIST1 protein, apoptosis and proliferation were measured after treatment with harmine in the CCSP-rtTA/tetO-KrasG12D/Twist1-tetO7-luc(CRT) mice.
Results:
We found that several of our CMAP compounds had significant growth inhibitory effects in NSCLC cell lines. Interestingly, a family of related harmala alkaloids including harmine ranked highly in our CMAP analysis. We observed that harmine could inhibit growth in KRAS mutant NSCLC cell lines through the induction of OIS or apoptosis and phenocopied genetic inhibition of TWIST1. Remarkably, harmine treatment led to TWIST1 protein degradation as well as degradation of its binding partners, the E2A proteins, E12/E47. Furthermore, the growth inhibitory effects of the harmala alkaloids correlated with the ability to degrade TWIST1 and were independent of its ability to inhibit the DYRK kinases. In addition, we demonstrated that heterodimer formation of TWIST1/E12/E47 resulted in a reciprocal stabilization of each binding partner and that E12/E47 are required for TWIST1 mediated suppression of OIS and apoptosis. Importantly, we found that harmine preferential targets the TWIST1-E12 heterodimer for degradation and the growth inhibitory effects of harmine are in due in at least part to the ability to inhibit the TWIST1/E12/E47 heterodimer as overexpression of the E2A proteins can suppress harmine induced cytotoxicity. Finally, we have demonstrated that harmine treatment lead to Twist1 protein degradation and tumor growth inhibition in our Kras[G12D]/Twist1 murine model of lung adenocarcinoma. We are currently testing and designing structure analogs of the initial candidate agents to develop more specific and potent inhibitors of TWIST1.
Conclusion:
We have identified a novel TWIST1 inhibitor harmine that induces degradation of TWIST1 and its binding partners, E12/E47 and inhibits the growth of KRAS mutant NSCLC both in vitro and in vivo. Therefore, we believe that targeting the TWIST1-E2A pathway would be an effective therapeutic strategy. Since TWIST1 is essential not only for KRAS mutant NSCLC but more broadly for oncogene driven NSCLC, the development of this novel class of TWIST1 inhibitors could have a significant clinical impact.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
MINI 22 - New Technology (ID 134)
- Event: WCLC 2015
- Type: Mini Oral
- Track: Biology, Pathology, and Molecular Testing
- Presentations: 1
-
+
MINI22.02 - Clinically Adoption of MSK-IMPACT, a Hybridization Capture-Based next Generation Sequencing Assay, for the Assessment of Lung Adenocarcinomas (ID 2881)
16:50 - 16:55 | Author(s): C.M. Rudin
- Abstract
- Presentation
Background:
Mutation analysis plays a central role in the management of lung adenocarcinomas (LUAD). The use of multiple single gene or mutation specific assays, broadly adopted in many laboratories to detect clinically relevant genomic alterations, often leads to delays if sequentially performed, tissue exhaustion, incomplete assessment and additional biopsy procedures. Comprehensive assays using massively parallel “next-generation” sequencing (NGS) offer a distinct advantage when addressing the increased testing needs of genotype-based therapeutic approaches. Here we describe our experience with a 410 gene, clinically validated, hybrid-capture-based NGS assay applied to testing of LUAD.
Methods:
Consecutive LUAD cases submitted for routine mutation analysis within a 1 year period were reviewed. Unstained slides of formalin fixed, paraffin embedded tissue were received for each case (range 15-20 slides/case). Corresponding H&E stained slides were reviewed and cell counts were performed in a subset of cases with limited material to establish minimal tissue requirements. Testing was performed by a laboratory-developed custom hybridization-capture based assay (MSK-IMPACT) targeting all exons and selected introns of 410 key cancer genes (J Mol Diagn 17:251-264, 2015). Barcoded libraries from tumor / normal pairs were captured and sequenced on an Illumina HiSeq 2500 and analyzed with a custom analysis pipeline.
Results:
A total of 469 specimens were received for comprehensive testing (98 cytology samples, 239 needle biopsies, 132 large biopsies/resections) of which 93% (436/469) were successfully tested. Thirty four cases (7%, 34/469) failed due to very low tumor content or low DNA yield. Cell counts for failed samples averaged 239 cells / slide (range 10-270) while all successfully tested had over 1,000 cells / slide each. Failure rate was similar for cytologies and biopsies. An average of 10 genomic alterations were detected per patient (range 1-96). The most frequently mutated genes were TP53, EGFR, KRAS, KEAP1 and STK11. Copy number gains of NKX2-1 and EGFR genes and CDKN2A loss were most common. EGFR mutations and ALK fusions were detected in 28% and 4% of cases, respectively. Among the 299 EGFR / ALK WT cases, MSK-IMPACT uncovered targetable genomic alterations that would have remained undetected through focused EGFR/ALK testing alone. These included fusions in RET (10) and ROS1 (13), mutations in ERBB2 (11) and BRAF (19) and amplifications in MET (12, unrelated to EGFR), MDM2 (26) and CDK4 (20) among others. The higher than expected rates of RET and ROS1 fusions are related to enrichment of previously tested cases known to be negative for other driver alterations.
Conclusion:
Comprehensive hybrid-capture based NGS assays such as MSK-IMPACT are an efficient testing strategy for LUAD across sample types. This upfront broad approach enables more optimal patient stratification for treatment by targeted therapeutics.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
MINI 27 - Biology and Other Issues in SCLC (ID 152)
- Event: WCLC 2015
- Type: Mini Oral
- Track: Small Cell Lung Cancer
- Presentations: 3
- Moderators:P.A. Bunn, Jr, J. Sage
- Coordinates: 9/09/2015, 16:45 - 18:15, 605+607
-
+
MINI27.02 - RPS25 Is Essential for the Translation of the Seneca Valley Virus Genome and Proliferative Capacity of Small Cell Lung Cancer Cell Lines (ID 3278)
16:50 - 16:55 | Author(s): C.M. Rudin
- Abstract
- Presentation
Background:
Small cell lung cancer (SCLC) is an extremely aggressive and lethal disease for which there is a desperate need for novel and more effective treatments. A recently discovered oncolytic picornavirus, Seneca Valley Virus (SVV), infects tumors with neuroendocrine features, including SCLC with high selectivity. SVV is highly effective in the eradication of solid tumors in multiple in vivo models; however the mechanism of selective tropism for SVV is unknown. Because of the strong selectivity of the virus for SCLC, we hypothesize the host determinants of SVV permissivity could constitute future druggable targets for the treatment of SCLC.
Methods:
A retroviral gene trap mutagenesis screen was utilized in HAP1, a haploid human cell line permissive to SVV, HAP1. Once mutagenized, resistant cells, or cells with retroviral insertion in a gene essential to the viral life cycle, were selected for by incubation of the pool with SVV at a high multiplicity of infection (MOI). Hits from this screen were deconvoluted using an insertion mapping approach. Illumina sequencing provided quantitative counts of each insertion site in each gene. Hits from the screen were validated using various mechanistic approaches.
Results:
Our screen identified multiple unique insertion sites in the gene RPS25 on Chromosome 11. The RPS25 protein is a ribosomal protein that is a component of the 40S subunit of the ribosome. RPS25 has been previously shown to be important for IRES-dependent translation of multiple viral genomes as well as cellular mRNAs containing IRES elements. Using the CRISPR-Cas9 approach, we knocked out the RPS25 gene in the SVV-permissive SCLC cell line, NCI-H446. Upon total knock-down of RPS25, H446 cells become completely resistant to cell killing by SVV at high MOI. Surprisingly, these cells also show a severely marked decrease in doubling time and robustness in culture. In contrast, RPS25 CRISPR knock-down in HEK293T cells has been previously shown to have no distinguishable phenotype other than defects in IRES-dependent translation. Further studies to fully characterize the interaction of RPS25 with the SVV genome as well as the importance of RPS25 in other SCLC cell lines are ongoing.
Conclusion:
We have identified a host protein that is essential for SVV replication and infection using a genome wide mutagenesis screen. SCLC cells completely defective in RPS25 are resistant to SVV-dependent cell killing. RPS25 appears to not only be important for the life cycle of SVV but may be important in proliferative capacity in SCLC. As SVV is highly selective for SCLC, we hypothesize that the host determinants of SVV tropism may be very specific to SCLC cells. Proteins important in the SVV life cycle may be novel “druggable” targets for the treatment of SCLC.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
MINI27.09 - A DLL3-Targeted ADC Effectively Targets Pulmonary Neuroendocrine Tumor-Initiating Cells to Result in Sustained Tumor Regressions (ID 2533)
17:30 - 17:35 | Author(s): C.M. Rudin
- Abstract
- Presentation
Background:
Pulmonary neuroendocrine tumors such as small cell lung cancer (SCLC) and large cell neuroendocrine cancer (LCNEC) remain among the most deadly malignancies and are increasing in incidence. Patient-derived xenograft (PDX) tumors provide excellent models to study tumor biology and discover tumor-initiating cell (TIC) populations. Novel therapies that target and eradicate TIC represent a promising strategy to improve survival. An effectively targeted antibody-drug conjugate (ADC) carrying a cell-cycle independent toxin should result in significant anti-tumor activity and eliminate TIC.
Methods:
Whole transcriptome sequencing was performed using TIC isolated by fluorescence-activated cell sorting from SCLC and LCNEC PDX tumors. Quantitative RT-PCR, microarray analysis of PDX tumors and cell lines, and mining of publically available transcriptome and proteome datasets were executed to validate that prospective targets, such as Delta-like protein 3 (DLL3), were highly expressed in neuroendocrine tumors, but limited in their expression in normal tissues. DLL3-specific monoclonal antibodies were generated and used to determine protein expression by immunohistochemistry, flow cytometry and ELISA. Select DLL3-specific antibodies were conjugated to a cell-cycle independent pyrrolobenzodiazepine (PBD) dimer toxin and evaluated for their ability to internalize and mediate cell killing. Finally, established SCLC and LCNEC PDX tumors were treated in vivo with a lead anti-DLL3 ADC (i.e. SC16LD6.5). Limiting dilution assay (LDA) serial transplantation experiments were executed to assess the impact of SC16LD6.5 on TIC.
Results:
Elevated expression of DLL3 mRNA was discovered in TIC of SCLC and LCNEC PDX tumors and confirmed in additional distinct primary SCLC and LCNEC tumor samples and PDX tumors. In contrast, little to no mRNA expression was detected in vital organs and other normal tissues outside of the brain. DLL3-specific antibodies confirmed protein expression on the cell surface in both primary SCLC and LCNEC tumors and in PDX tumors initiated from patients with these diseases, whereas protein was scarce in normal tissues. SC16LD6.5 rapidly internalizes and localizes to late endosomes, and treatment of 10 SCLC and 2 LCNEC PDX tumor models resulted in significant and durable tumor regression with a median time to progression benefit of 75 days versus 16 days with standard-of-care (SOC: SCLC, cisplatin/etoposide; LCNEC, cisplatin). During the course of these in vivo studies, many mice were cured as tumors often did not recur despite being followed for 120+ days post-randomization and treatment. LDA experiments executed using tumors actively responding to SC16LD6.5 provided further functional evidence that the common lack of tumor recurrence following treatment resulted from effective targeting of DLL3-expressing TIC. In vivo efficacy strongly correlated with DLL3 protein expression, and responses were observed in PDX tumor models initiated from patients with both limited and extensive stage disease and independent of their sensitivity to SOC.
Conclusion:
The DLL3-targeted ADC, SC16LD6.5, effectively targets and eradicates TIC in SCLC and LCNEC PDX tumors. SC16LD6.5 (i.e. rovalpituzumab teserine) is currently concluding Phase 1b trials and is a promising first-in-class therapeutic for the treatment of high grade pulmonary neuroendocrine tumors.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
MINI27.11 - Comprehensive Mutation Analysis of Never-Smokers with Small Cell Lung Cancer (SCLC) (ID 3135)
17:45 - 17:50 | Author(s): C.M. Rudin
- Abstract
- Presentation
Background:
Although most patients with SCLC are current or former smokers, this disease has been reported in never-smokers. In our prospective genomic profiling of SCLC patients, we have identified four never-smokers. Here, we report next generation sequencing (NGS) results for these four SCLC patients and describe how they differ from those of smokers.
Methods:
We are evaluating pathologically confirmed SCLC tumors in patients undergoing treatment. Formalin-fixed, paraffin-embedded surgical resections, core biopsies, and fine needle aspirates are being evaluated using a targeted, hybrid capture-based, NGS assay, MSK-IMPACT, which identifies single nucleotide variants, indels, and copy number alterations in 341 cancer-associated genes. We determined never-smoking status prospectively: all smoked <100 cigarettes in their lifetime. Clinical data on stage [extensive (ES), limited (LS)], treatment, and response were collected.
Results:
Four never-smokers have been identified within the 50 patient samples that have undergone NGS evaluation thus far. The median age at diagnosis of the four never-smokers is 58 (range, 47-75); 50% are male; and one presented with LS-SCLC. None of these four patients developed SCLC as acquired resistance to EGFR tyrosine kinase inhibitors after treatment for EGFR-mutant lung cancers. The tumors from the four never-smokers displayed a median of 3 non-synonymous somatic mutations, while those from moderate (<20 pack years) and heavy (20+ pack years) smokers contained 4.5 and 8 mutations, respectively (P<0.05). None of the four never-smoker samples contained smoking associated G-to-T transversions (see Table). Inactivation of RB1 and TP53 occurred in 75% and 50% of the samples, respectively. Only patient 4 had platinum-refractory disease. The median survival of these patients was 20.7 months (range, 17 to 25).Sample Gene altered Alteration Present Protein Alteration Base Pair Alteration Patient 1 PHOX2B Missense Mutation P82L G-to-A NOTCH1 Frame-Shift Insertion P2485fs RB1 Splice Site R500_splice G-to-A TP53 Frame-Shift Deletion V218fs TP53 Frame-Shift Deletion V73fs TERT Amplification Patient 2 CBL Missense Mutation C401S G-to-C GNAS Missense Mutation M102V A-to-G MYCL Amplification Patient 3 TP53 Nonsense Mutation R342 G-to-A RB1 Frame-Shift Insertion T197fs CDKN2C Amplification MYCL Amplification Patient 4 RB1 Nonsense Mutation C666 ETV1 Amplification
Conclusion:
Using a targeted NGS assay, we have shown that the molecular characteristics differ between never-smokers and smokers, while the majority of the tumors demonstrate RB loss. Whole exome sequencing of the tumors from these never-smokers is underway. Ongoing comprehensive, multiplexed genotyping is needed to fully characterize the molecular diversity of SCLC in this unique population.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
MS 07 - SCLC Biology & Models (ID 25)
- Event: WCLC 2015
- Type: Mini Symposium
- Track: Biology, Pathology, and Molecular Testing
- Presentations: 1
- Moderators:D. Carney, C.M. Rudin
- Coordinates: 9/07/2015, 14:15 - 15:45, Mile High Ballroom 4a-4f
-
+
MS07.01 - PDX Models (ID 1872)
14:20 - 14:35 | Author(s): C.M. Rudin
- Abstract
- Presentation
Abstract not provided
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
ORAL 03 - New Kinase Targets (ID 89)
- Event: WCLC 2015
- Type: Oral Session
- Track: Treatment of Advanced Diseases - NSCLC
- Presentations: 1
- Moderators:F. Blackhall, R. Juergens
- Coordinates: 9/07/2015, 10:45 - 12:15, Mile High Ballroom 4a-4f
-
+
ORAL03.07 - Response to MET Inhibitors in Stage IV Lung Adenocarcinoma Patients with Mutations That Cause MET Exon 14 Skipping (ID 2764)
11:50 - 12:01 | Author(s): C.M. Rudin
- Abstract
- Presentation
Background:
Mutations in the MET exon 14 RNA splice acceptor and donor sites, which lead to exon skipping, deletion of the juxtamembrane domain, and loss of Cbl E3-ligase binding to the resultant aberrant MET protein, were previously reported to be oncogenic in preclinical models (Kong-Beltran, Cancer Res 2006). These mutations occur in 4% of lung adenocarcinomas but have not been clinically assessed (TCGA 2014). We now report responses to the MET inhibitors crizotinib and cabozantinib in patients with stage IV lung adenocarcinomas harboring mutations leading to MET exon 14 skipping.
Methods:
Patients with stage IV lung adenocarcinomas harboring MET exon 14 splice site mutations (N=6) or a mutation deleting Y1003 in exon 14 (N=1) were identified through a clinical assay based on hybrid capture/next-generation sequencing of 341 oncogenes and tumor suppressors (MSK-IMPACT). MET IHC was performed on archival FFPE tissue. RNA skipping was confirmed by NanoString. Radiographic response to MET inhibition was assessed using RECIST 1.1 and PERCIST criteria.
Results:
Clinicopathologic data for those treated (N=4) are in the table below:
To date, 3 patients have been treated with off-label crizotinib and 1 with cabozantinib (NCT01639508). Three of four patients (75%) developed a PR to treatment. The remaining patient had SD by RECIST, with PET imaging demonstrating a complete PERCIST response to treatment.ID Age Sex Smoking status (pack years) MET exon 14 variant MET therapy Response MET IHC (H-score) 1 65 M C (20) MET p.V1001_F1007del (c.3001_3021delGTAGACTACCGAGCTACTTTT) crizotinib (3rd line) PR (-31%) NA 2 80 M F (20) MET c.3024_3028delAGAAGGTATATT crizotinib (3rd line) PR (-30%) 300 3 90 F N MET c.3028G>C crizotinib (3rd line) PR (-47%) NA 4 80 F N MET c.3028G>C cabozantinib (3rd line) SD (0%), CR (PERCIST) 300
Conclusion:
MET exon 14 skipping is a novel oncogenic target that predicts for response to MET inhibitors. This appears to be a substantially better predictor of response than either protein expression or gene amplification. Patients with these splice site mutations should be treated on a clinical trial of a MET inhibitor. For those without access to a trial, use of off-label crizotinib should be considered.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
ORAL 10 - SCLC (ID 98)
- Event: WCLC 2015
- Type: Oral Session
- Track: Small Cell Lung Cancer
- Presentations: 1
- Moderators:C. Faivre-Finn, P. Lara Jr.
- Coordinates: 9/07/2015, 10:45 - 12:15, 605+607
-
+
ORAL10.01 - A DLL3-Targeted ADC, Rovalpituzumab Tesirine, Demonstrates Substantial Activity in a Phase I Study in Relapsed and Refractory SCLC (ID 1598)
11:05 - 11:16 | Author(s): C.M. Rudin
- Abstract
Background:
Rovalpituzumab tesirine (i.e. SC16LD6.5) is a Delta-like protein 3 (DLL3) targeted antibody-drug conjugate (ADC) comprised of a humanized monoclonal antibody, dipeptide linker, and pyrrolobenzodiazepine (PBD) dimer toxin with a drug-to-antibody ratio of 2. DLL3 is highly expressed in human neuroendocrine tumors and their tumor-initiating cells, including approximately two-thirds of small cell lung cancer (SCLC). DLL3 is not expressed at detectable levels in normal tissues. Rovalpituzumab tesirine induced tumor regression and prolonged time to progression significantly outperforming cisplatin/etoposide in DLL3-expressing SCLC patient-derived xenograft tumor models. Based on this promising activity, a first-in-human phase I trial in patients (pts) with recurrent SCLC was initiated and preliminary results are reported below.
Methods:
SCLC pts with progressive disease after 1 or 2 previous lines of therapy received escalating doses of rovalpituzumab tesirine as a single agent once every 3 weeks (Q3W) in 1-3 pt cohorts until dose limiting toxicities (DLTs) were observed. The doses were 0.05, 0.1, 0.2, 0.4 and 0.8 mg/kg Q3W. Midway through accrual, pharmacokinetic data revealed a longer than expected ADC half-life of ~11 days, prompting evaluation of a Q6W schedule. A DLL3 antibody was developed and utilized to assess antigen expression in archived tumor specimens. Biomarker positive (BM+) tumors were defined by IHC membrane-associated H-Scores ≥ 120.
Results:
52 pts were treated: 34 Q3W and 18 Q6W; 24F/28M; median age, 61 years (44-82). Acute and chronic DLTs of thrombocytopenia and capillary leak syndrome (CLS) were observed at 0.8 and 0.4 mg/kg Q3W, respectively. Maximum tolerated doses (MTD) of 0.2 mg/kg Q3Wx3 cycles and 0.3 mg/kg Q6Wx2 cycles were further evaluated in expansion cohorts. The most common treatment emergent adverse events of any grade among all pts were fatigue (40%), rash (39%), nausea (29%), dyspnea (23%), decreased appetite (21%) and vomiting (21%). Grade 3+ CLS and thrombocytopenia were seen in 7 (14%) and 3 (6%) pts, respectively, with no reported Grade 5 toxicity. Of 38 archived tumor specimens received from enrolled pts, 23 (61%) were DLL3 BM+. Among the 16 confirmed DLL3 BM+ pts treated at the MTDs, 7 pts (44%) had partial response (PR) and 8 pts (50%) achieved stable disease (SD) for a combined clinical benefit rate (CBR) of 94%. In all evaluable pts treated at the MTD without regard for DLL3 biomarker status (n=32), the ORR was 22% (n=7 PR) and SD 53% (n=17), for a CBR of 75%. Notably, all pts with PRs that were treated at the MTD, and those having the most durable clinical benefit (up to 569 days OS), were BM+. Similar response rates were observed among pts sensitive and refractory to first-line therapy, and in the third-line setting where no standard-of-care currently exists.
Conclusion:
Rovalpituzumab tesirine, a first-in-class DLL3-targeted ADC, has manageable toxicity and demonstrated significant anti-tumor activity (44% ORR and 95% CBR) as a single agent in second- and third-line pts with recurrent DLL3 BM+ SCLC. A pivotal study is being planned.
-
+
ORAL 13 - Immunotherapy Biomarkers (ID 104)
- Event: WCLC 2015
- Type: Oral Session
- Track: Biology, Pathology, and Molecular Testing
- Presentations: 1
- Moderators:D. Kim, D. Grunenwald
- Coordinates: 9/07/2015, 16:45 - 18:15, Four Seasons Ballroom F3+F4
-
+
ORAL13.03 - Spatiotemporal Effects on Programmed Death Ligand 1 (PD-L1) Expression and Immunophenotype of Non-Small Cell Lung Cancer (NSCLC) (ID 1609)
17:07 - 17:18 | Author(s): C.M. Rudin
- Abstract
Background:
PD-L1 is one of the immune-checkpoint molecules that regulates Th1 immune responses and mediates cancer immune evasion. PD-L1 can be expressed on tumor cells (TC) or tumor-infiltrating immune cells (IC) and expression in both cell types can negatively regulate T-cell function in the tumor microenvironment. The goal of this study was to evaluate the intra-patient heterogeneity and temporal changes in PD-L1 expression and overall immune phenotype in NSCLC using paired synchronous and metachronous tumor specimens.
Methods:
Thirty-nine patients (pts) with NSCLC treated at Memorial Sloan Kettering Cancer Center were evaluated as part of an IRB approved project. Most were former/current smokers (n=30, 77%) and had adenocarcinoma histology (n=36, 92%). 17 pts were KRAS mutant (45%), and 5 were EGFR mutant (13%). Paired synchronous samples were collected from 17 pts with stage IIIA-N2 resected primary lung and metastatic lymph node (met LN) tissue. Paired metachronous samples were collected from 23 pts (including one patient also with synchronous tissue) with at least two metachronous primary/metastatic (n=14) or metastatic/metastatic tissues (n=9). In pts with metachronous samples, 14 (61%) had systemic intercurrent anti-cancer therapy and 9 (39%) had none. PD-L1 expression was assessed by IHC (clone SP142) on TC and IC. CD8 expression was evaluated by IHC using the C8/144 clone. In addition, expression of ~600 immune genes was analyzed by iChip.
Results:
Twenty-five out of 39 tissue pairs were evaluable by PD-L1 IHC (14/17 synchronous, 11/23 metachronous). Among pts with synchronous samples, in the primary tumor, PD-L1 was expressed in <1% of TC or IC in 6 pts, in 1-4% of cells in 5 pts, and in ≥5% of cells in 3 pts. Among those with metachronous samples, in the first collected sample, the PD-L1 expression in <1% of TC or IC was detected in 6 pts, in 1-4% of cells in 2 pts, and in ≥5% of cells in 3 pts. PD-L1 expression was similar across all paired tissues. PD-L1 status at the TC or IC 5% cut-off remained unchanged in all evaluable paired specimens and at the TC or IC 1% cut-off remained unchanged in 80% (11/14 synchronous and 9/11 metachronous) pairs. In both synchronous and metachronous samples, CD8 expression was also similar across paired specimens. The median inter-sample difference in CD8+ T-cell infiltration was 0.5% (95% CI: -0.6% - 3.4%) in synchronous pairs; three pts had a difference >5%. In metachronous pairs, the median difference was -0.4% (95% CI: -1.4% - 0.1%); one pt had a >5% change in CD8+ T-cell infiltration.
Conclusion:
In this study, there was a high agreement in PD-L1 expression and CD8+ T-cell infiltration in both paired synchronous and metachronous NSCLC specimens. The low intra-patient heterogeneity of PD-L1 and CD8 expression in this study suggests any available tissue (e.g. primary or met) may be reliable to assess these markers in NSCLC. Overall immune characterization by gene expression analysis in paired tumor specimens will be presented.
-
+
ORAL 25 - Biology and Other Issues in SCLC (ID 125)
- Event: WCLC 2015
- Type: Oral Session
- Track: Small Cell Lung Cancer
- Presentations: 2
- Moderators:J. Sage, L. Montuenga
- Coordinates: 9/08/2015, 10:45 - 12:15, 605+607
-
+
ORAL25.04 - Discussant for ORAL25.01, ORAL25.02, ORAL25.03 (ID 3360)
11:18 - 11:28 | Author(s): C.M. Rudin
- Abstract
- Presentation
Abstract not provided
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
ORAL25.07 - DNA Methylation in Small Cell Lung Cancer Defines Distinct Disease Subtypes and Correlates with High Expression of EZH2 (ID 3031)
11:50 - 12:01 | Author(s): C.M. Rudin
- Abstract
- Presentation
Background:
Small cell lung cancer (SCLC) is an aggressive neuroendocrine lung tumor characterized by extreme plasticity, high metastatic potential, and capacity for acquired resistance to chemotherapy. Despite significant advances in our understanding of SCLC genetics and etiology, the epigenetics of this deadly disease remain under studied. This study profiles DNA methylation in primary SCLC, patient-derived xenografts (PDX) and cell lines at single-nucleotide resolution.
Methods:
This study profiled DNA methylation at single-nucleotide resolution in 47 extensively characterized SCLC samples, including 34 fresh frozen primary SCLC tumors as well as 6 distinct primary patient-derived xenografts and 7 cell lines using the Illumina Human Methylation 450k Bead Chip array. Importantly, 24 primary SCLC in this study have previously been analyzed by whole exome sequencing and RNAseq, allowing integrated analysis of these data types with measurements of DNA methylation. We applied unsupervised clustering, discrete and locally clustered differential methylation analysis, correlation with gene expression, spacial correlation with genomic features, and interrogated the role of the EZH2 methyltransferase in SCLC using bioinformatic and pharmacologic approaches.
Results:
Unsupervised clustering of all samples revealed that PDX clustered with primary SCLC, while cell lines were easily discriminated. We explored this phenomenon further and found that while the top differentially methylated CpGs in both PDX and cell lines were >80% concordant with primary SCLC, only PDX maintained high concordance across larger probe lists. Unsupervised clustering of primary SCLC revealed three distinct subgroups at both the DNA methylation and gene expression levels that correlated with expression of the neurogenic transcription factors ASCL1 and NEUROD1. The chromatin modifier EZH2 was expressed >12-fold higher in SCLC than in normal lung. In addition to the high expression observed in SCLC compared to normal lung, we observed a significant correlation between median EZH2 gene expression and promoter methylation using data from The Cancer Genome Atlas (TCGA). Overall, EZH2 expression in SCLC is greater than or comparable to that of any other tumor type represented in TCGA. EZH2 protein expression was detected by Western blot in 15/17 SCLC PDXs (88%). We assessed the efficacy of the potent EZH2 inhibitor EPZ-5687 in the LX92 SCLC PDX in vivo. EPZ-5687 was well-tolerated and demonstrated remarkable efficacy at 100 mg/kg either QD or BID.
Conclusion:
DNA methylation patterns in primary SCLC are more closely mirrored by those found in PDX, compared to cell lines, including PDX lines of very high passage. Distinct epigenetic subtypes could be observed in SCLC, even among histologically indistinguishable samples with similar mutation profiles. SCLC is notable for consistent high level DNA methylation clustered in promoters containing CpG islands. Promoter methylation in SCLC is distinct from other lung cancers and correlates strongly with high-level expression of the histone methyltransferase gene EZH2. Pharmacologic inhibition of EZH2 in a SCLC PDX markedly inhibited tumor growth. These findings point to a critical role of EZH2 in SCLC tumor biology and support further preclinical efficacy studies in models of SCLC.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
P2.04 - Poster Session/ Biology, Pathology, and Molecular Testing (ID 234)
- Event: WCLC 2015
- Type: Poster
- Track: Biology, Pathology, and Molecular Testing
- Presentations: 1
- Moderators:
- Coordinates: 9/08/2015, 09:30 - 17:00, Exhibit Hall (Hall B+C)
-
+
P2.04-050 - Basaloid Squamous Cell Cancers Arising from the Lung: Next Generation Sequencing Reveals PTCH1 Mutations in the Hedgehog Pathway (ID 3211)
09:30 - 09:30 | Author(s): C.M. Rudin
- Abstract
Background:
Basaloid squamous cell lung cancers are a defined variant of non-small cell lung cancers associated with a high mitotic count and rapid clinical progression. Due to its morphologic similarities with basal cell carcinoma of the skin, distinguishing between the two can be difficult. We sought to define the molecular characteristics of basaloid squamous cell cancers that were clinically defined as possible lung primaries in an effort to aid in the diagnosis of this disease.
Methods:
We reviewed a total of 179 patients who were diagnosed with squamous cell lung cancers and had undergone tumor next generation sequencing at Memorial Sloan Kettering. Through the MSK-Integrated Mutation Profiling for Actionable Cancer Targets (MSK-IMPACT), the illumina HiSeq platform was used to detect 341 potentially actionable genetic alterations, including single base substitutions, indels, copy number alterations and selected gene fusions. Data on clinicopathologic characteristics, smoking history were reviewed, and their mutational profile described.
Results:
A total of 6 of 179 (2%) patients with squamous cell lung cancers were found to have basaloid features. Of the 6 patients with basaloid features, 5 (83%) were men, 2 (33%) were never-smokers, 6 (100%) were white Caucasians, 3 (50%) had resected lung specimens, and 2 (33%) presented with stage IV disease. Three cases (50%) had protein patched homolog 1 (PTCH1) mutations in the hedgehog pathway (H652Y, V1057splice, V579fs), identical to those found in basal cell carcinoma of the skin. Two of these patients had a history of basal cell carcinoma of the skin, raising the possibility of metachronous metastatic basal cell carcinoma of the skin. One patient had no such history of basal cell skin cancer.
Conclusion:
Basaloid squamous cell cancers that appear to arise from the lung frequently harbor PTCH1 mutations. Metachronous metastatic basal cell carcinoma of the skin needs to be considered as a possibility in patients with a history of superficial skin lesions. Patients diagnosed with these basaloid cancers that harbor PTCH1 mutations, whether from skin or lung origin, may benefit from hedgehog pathway inhibitors such as vismodegib.
