Virtual Library
Start Your Search
F. Blackhall
Moderator of
-
+
ORAL 03 - New Kinase Targets (ID 89)
- Event: WCLC 2015
- Type: Oral Session
- Track: Treatment of Advanced Diseases - NSCLC
- Presentations: 8
- Moderators:F. Blackhall, R. Juergens
- Coordinates: 9/07/2015, 10:45 - 12:15, Mile High Ballroom 4a-4f
-
+
- Abstract
- Presentation
Background:
Anlotinib is a multi-target RTK inhibitor, especially on VEGFR2/3, EGFR, c-Kit, PDGF, FDFR, c-MET, with highly selective inhibition effect. This phase II study was to investigate efficacy and safety of anlotinib in refractory NSCLC patients
Methods:
Patients ≥18 years with metastatic or recurrent advanced NSCLC and ECOG status of 0–1 were randomized 1:1 to receive Anlotinib or placebo (Anlotinib 12mg/day, po, day 1-14 each 3-week) until progression, unacceptable toxicity, withdrawal or death. Patients had received first and second line treatment for advanced NSCLC. Patients were stratified by gender, smoking status and age. We used RECIST (version 1.1) criteria to assess response and progression. Primary endpoint was PFS in ITT population; secondary endpoints included ORR, OS, biomarkers and safety.
Results:
From Aug. 2013 to May 2014, we enrolled 117 patients from 13 centers, including 60 patients to anlotinib arm and 57 patients to placebo. Baseline characteristics were similar in both treatment groups. PFS was prolonged with anlotinib 4.83 month vs placebo 1.23 months (HR 0.32, 95% CI 0.20–0.51, p<0.0001). ORR was improved with addition of anlotinib: 10% vs 0% with placebo (p<0.027).DCR was 83.3% with anlotinib vs 31.5% with placebo (p<0.0001). mOS was prolonged with Anlotinib 10.33 months vs placebo 6.3 months. (HR, 0.656; 95% CI, 0.411 to 1.048; P = 0.0776; Cutoff date: April 12, 2015. This mOS is an estimated data, OS events for both arms still not reach 75%). OS rate of >12 months is 22.8% in placebo arm and 38.3% in anlotinib arm. AEs occurred more frequently with anlotinib than placebo; the most common AEs of any grade were hypertension (53.33%), increased TSH (36.67%), hand foot syndrome (28.33%), increased TG (26.67%), increased TC (25%), cough (21.67%), diarrhea (21.67%), increased LDL (16.67%), hemoptysis (16.67%) oral mucositis (13.33%), and sore throat (13.33%). Grade III/IV treatment-related AEs increased 16.4% in anlotinib group (anlotinib: 21.6% , placebo: 5.3%, p=0.0140).
Conclusion:
This study confirms that anlotinib to third-line platinum-based chemotherapy appears to provide significant PFS benefits in Chinese patients with refractory advanced NSCLC compared with placebo. No serious safety concerns were reported in the study.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
ORAL03.02 - Is EGFR Exon20 Mutation a Prognostic/Predictive Biomarker in Our Lung Cancer Patients? (ID 2744)
10:56 - 11:07 | Author(s): D.S. Joy Philip, A. Choughule, N. Jambhekar, V. Patil, A. Joshi, V. Naronha, K. Prabhash
- Abstract
- Presentation
Background:
EGFR Exon20 mutations have been considered to be markers of acquired resistance to Tyrosine Kinase inhibitors. The association between Oral TKI response and Baseline Exon20 Mutations has not been addressed in many studies and remains to be evaluated.
Methods:
We conducted a retrospective audit of our prospectively maintained Lung cancer audit database in our institute in the year 2014.We reviewed data related to EGFR mutation testing by RQ-PCR using endpoint genotyping assay for EXON 20, 19, 21.We also reviewed data relating to baseline demographics,clinical profile, patient treatment and outcome measures in terms of response and survival.
Results:
We reviewed 807 sequentially tested lung cancer patients, who underwent molecular testing using RQ-PCR by endpoint genotyping assay. The overall mutation rate was 26.4% and 19 (2%) had baseline EGFR EXON20 mutation. The median age of patients was 56yrs [range: 29-81yrs], with 7 patients being females .There were 7 patients who gave past history of smoking. The most common site of metastasis was pleural effusion in 8,followed by Bone in 6,Brain in 5 and Liver metastasis in 2patients.Histology was adenocarcinoma in majority[16 patients].Among the types of EXON20 Mutations, 7 patients had S7681, 4 patients had INSGGT, 5patients had INS 9 and 4 patients had T790M mutation. All patients received chemotherapy as first line treatment. We have documented response assessment at 2months in 8 patients with progressive disease in 5[63%], stable disease in 2 and partial response in 1 patient. Second line therapy with Oral TKI was given to 9 patients, in whom we have documented response assessment in 6, all of whom had progressed.The median Overall survival of Exon-20 mutation positive patients was 5.5months. [Range of 3.8-7.2months], in comparison with other types of EGFR mutations which showed median Overall survival of 16.3months[range:12.7-19.4months
Conclusion:
EXON-20 Mutations in general proclaim grave prognosis, predicting limited benefit of chemotherapy and marked TKI resistance.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
ORAL03.03 - EGFR Exon 18 Mutations in Lung Cancer: Molecular Predictors of Sensitivity to Afatinib or Neratinib but Not to Other EGFR-TKIs (ID 1748)
11:07 - 11:18 | Author(s): Y. Kobayashi, Y. Togashi, Y. Yatabe, H. Mizuuchi, P. Jangchul, C. Kondo, M. Shimoji, K. Sato, K. Suda, K. Tomizawa, T. Takemoto, T. Hida, K. Nishio, T. Mitsudomi
- Abstract
- Presentation
Background:
Lung cancers harboring common EGFR mutations respond to EGFR tyrosine kinase inhibitors (TKIs),whereas exon 20 insertions (Ins20) are known to be resistant to these drugs. However, little is known about the role of mutations in exon 18. Inspired by clinical observation that a patient with adenocarcinoma harboring exon 18 deletion (Del18: delE709_T710insD) responded to afatinib, this study aimed to establish a rational therapeutic strategy for lung cancers harboring exon 18 mutations.
Methods:
The mutational status of lung cancers registered in Aichi Cancer Center (ACC) database between 2001 and 2015 was reviewed. Three representative mutations in exon 18, Del18, E709K, and G719A, were introduced into Ba/F3, NIH3T3, and HEK293 cells using retroviral vector. The 90% inhibitory concentrations (IC90s) of first generation (1G) (gefitinib and erlotinib), second generation (2G) (afatinib, dacomitinib, and neratinib), and third generation (3G) TKIs (AZD9291 and CO1686) in these cells were determined and compared with the corresponding IC90s in cells expressing exon 19 deletion (Del 19) and with the trough concentration (C~trough~) at the recommended doses for each drug. Clinical data on the treatment response of tumors harboring exon 18 mutations were collected from the ACC and Catalogue of Somatic Mutations in Cancer (COSMIC) databases.
Results:
Among the 1355 EGFR mutations registered in the ACC database, Del19, L858R, and Ins20 were detected in 40%, 47%, and 4%, respectively. Of note, exon 18 mutations including G719X, E709X, and Del18 were present in 3.2% (n=43), accounting for 38% of the remaining. According to the COSMIC database, exon 18 mutations accounted for 4.1% (654/16,138) of all EGFR mutations present from exons 18-21. Mutations at codons 709 and 719 accounted for 84% of all exon 18 mutations. Ba/F3 cells expressing Del18, E709K, or G719A grew in the absence of interleukin 3, and NIH3T3 cells transfected with these mutations formed foci with marked pile-up, indicating that these mutations act as oncogenic drivers. IC90s of 1G and 3G TKIs in cells transfected with Del18, E709K and G719A were much higher than those in cells transfected with Del19 (by >50-, >25-, and >11-fold, respectively). In contrast, IC90 of afatinib in these three mutations ranged from only 2- to 6-fold greater than that in Del19 and was <1/40 of its C~trough~. Notably, cells transfected with exon 18 mutations exhibited higher sensitivity to neratinib (by 25-fold for E709K, by 5-fold for G719A, and by a comparable extent for Del 18) than those expressing Del19. Western blot analyses showed that these differential sensitivities corresponded to different degrees of suppression of EGFR phosphorylation in HEK293 cells. Furthermore, analyses of the ACC and COSMIC databases clearly indicated that patients with lung cancers harboring G719X exhibited higher response rate to afatinib or neratinib (~80%) than to 1G TKIs (35-56%).
Conclusion:
Our data indicated that lung cancers harboring exon 18 mutations, although rare, should not be overlooked in clinical practice and that these cases are best treated with afatinib or neratinib, although the currently available in vitro diagnostic kits do not detect all exon 18 mutations.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
ORAL03.04 - Discussant for ORAL03.01, ORAL03.02, ORAL03.03 (ID 3292)
11:18 - 11:28 | Author(s): H. West
- Abstract
- Presentation
Abstract not provided
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
ORAL03.05 - Clinical Outcomes with Pemetrexed-Based Systemic Therapy in RET-Rearranged Lung Cancers (ID 2813)
11:28 - 11:39 | Author(s): A. Drilon, I. Bergagnini, L. Delasos, C.S. Sima, R. Smith, R. Somwar, G.J. Riely, M.G. Kris
- Abstract
- Presentation
Background:
Previous series have shown that clinical benefit with pemetrexed-based systemic therapy can be durable in patients with ALK- and ROS1-rearranged lung cancers. The benefit of pemetrexed-based treatment in RET-rearranged lung cancers relative to other genomic subsets has not been explored.
Methods:
A retrospective review of records of patients treated at Memorial Sloan Kettering between 2007-2014 was conducted. Eligibility criteria: pathologically-confirmed advanced (stage IIIB/IV) non-small cell lung carcinoma, treatment with pemetrexed as monotherapy or in combination with other systemic agents, documented evidence of a rearrangement involving RET, ROS1, or ALK, or a KRAS mutation. Screening for these alterations was performed via break apart fluorescence in situ hybridization, multiplex mutation hotspot testing (Sequenom), or next-generation sequencing (MSK-IMPACT, Illumina HiSeq). Progression-free survival (PFS) and time to progression (TTP) were calculated using Kaplan-Meier estimates from the date of initiation of pemetrexed-containing therapy, and overall survival (OS) from diagnosis of metastatic disease. Overall response rate (ORR, RECIST v1.1), PFS, TTP, and OS were compared between RET-rearranged lung cancers and control groups (ALK- and ROS1-rearranged and KRAS-mutant lung cancers).
Results:
Data from 104 patients (RET-rearranged n=17, ROS1-rearranged n=10, ALK-rearranged n=36, KRAS-mutant n=41) were evaluated. As expected, median pack-year cigarette smoking history significantly differed between groups (p<0.001): RET 0 (0-48 range), ROS1 0 (0-12), ALK 0 (0-74), KRAS 38 (0-93). Features such as line of pemetrexed therapy (first vs other, p=0.1186), type of therapy (platinum combination, non-platinum combination, vs single-agent, p=0.1435), and need for dose reduction (p=0.9772) did not differ between groups. ORR, TTP, PFS, and OS in RET-rearranged lung cancers were not significantly different compared to ALK- and ROS1-rearranged lung cancers, and improved compared to KRAS-mutant lung cancers (Table 1). Table 1. Clinical Outcomes of Pemetrexed-Based TherapyRET ROS1 ALK KRAS p-value ORR 45% 78% 50% 26% 0.0242 Median TTP (months) NR (20-NR) 32 (14-NR) NR 7 (5-14) <0.001 ALK vs ROS1 vs RET (p=0.90); RET vs KRAS(p=0.009) Median PFS 20 (10-NR) 23 (14-NR) 24 (15-38) 6 (5-9) <0.001 ALK vs ROS1 vs RET (p=0.94); RET vs KRAS(p=0.002) Median OS NR (24-NR) NR (24- NR) 37 (30-63) 16 (13-29) <0.001 ALK vs ROS1 vs RET (p=0.43); RET vs KRAS(p=0.002)
Conclusion:
Clinical benefit with pemetrexed-based therapy in RET-rearranged lung cancers can be durable and is comparable to ALK- and ROS1-rearranged lung cancers. Outcomes in RET-, ROS1-, and ALK-rearranged lung cancers were improved compared to KRAS-mutant lung cancers. Mechanisms responsible for pemetrexed sensitivity in these subsets should continue to be explored. Driver-independent factors such as smoking history may contribute to clinical benefit.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
ORAL03.06 - Activity of Crizotinib in MET Amplified NSCLC: Preliminary Results of the AcSé Trial (ID 1200)
11:39 - 11:50 | Author(s): D. Moro-Sibilot, M. Le Deley, G. Zalcman, S. Bota, R. Sabatier, P.J. Souquet, L. Favier, M. Poudenx, P. Bombaron, C. Audigier-Valette, P. Bernard, P. Foucher, N. Girard, J. Merlio, L. Arnould, G. Ferretti, T. Mortier, E. Lonchamp, G. Vassal, C. Mahier - Ait Oukhatar
- Abstract
- Presentation
Background:
Crizotinib (crz) is registered only for the treatment of patients (pts) with ALK-translocated lung cancer. Crz is also a MET inhibitor. MET is amplified in several malignancies. Activity of crz in MET amplified (+) tumors was explored as part of the French National Cancer Institute (INCa) AcSé program, including both access to tumor molecular diagnosis and an exploratory multi-tumor 2-stage design phase II trial. We report here results in pts with MET + NSCLC.
Methods:
MET analysis on formalin-fixed, paraffin-embedded tumor samples was proposed in 170 investigating centers and performed in 28 regional INCa molecular genetic centers. MET+ was explored by FISH in tumor samples showing an IHC score of ≥2+. Pts with a tumor showing > 6 MET copies, whatever the MET/CEN7 ratio, were eligible, providing they were not eligible for any other academic or industry trial evaluating another MET inhibitor. Study treatment consisted in crz 250 mg BID. The objective response rate (ORR) and disease control rate (DCR) were assessed every 8 weeks, using RECIST v1.1.
Results:
From Aug. 5, 2013 to Mar. 1, 2015, 25 pts with MET+ NSCLC were enrolled and received crz. Median age was 59 years (range 30–92). Forty-four percent were females, 92% had tumors of non-squamous histology, and 96% presented with metastatic disease at study entry. Median number of prior treatments was 2 (range 0 – 11). Eight pts were still on treatment at the cut-off date, 17 have stopped crz (15 progressive diseases (PD), 1 adverse event (AE), 1 patient’s choice). Among the 18 pts evaluable for response after 8 weeks, we observed 7 partial responses, 6 stable diseases and 5 PD, leading to an ORR of 39% [95% CI:17-64], and a DCR of72% [47-90]. DCR at 6 months was 22% (4 pts out of the 18 evaluable pts). Crz was well tolerated with only 5 grade ≥3 (2 AE + 3 SAEs) and 3 grade 1-2 SAEs. Most common AEs, mainly grade 1 or 2, were nausea (60% of pts), visual disorders (52%), anemia (52%), elevated transaminases (48%) and vomiting (40%).
Conclusion:
Nationwide biomarker-driven access to crz for pts with MET+ malignancy is feasible. Crz was well tolerated and showed responses in pretreated MET+ lung cancers. Survival data and duration of response will be presented.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
ORAL03.07 - Response to MET Inhibitors in Stage IV Lung Adenocarcinoma Patients with Mutations That Cause MET Exon 14 Skipping (ID 2764)
11:50 - 12:01 | Author(s): P. Paik, A. Drilon, H. Yu, N. Rekhtman, L. Borsu, M. Ginsberg, M. Berger, M. Ladanyi, C.M. Rudin
- Abstract
- Presentation
Background:
Mutations in the MET exon 14 RNA splice acceptor and donor sites, which lead to exon skipping, deletion of the juxtamembrane domain, and loss of Cbl E3-ligase binding to the resultant aberrant MET protein, were previously reported to be oncogenic in preclinical models (Kong-Beltran, Cancer Res 2006). These mutations occur in 4% of lung adenocarcinomas but have not been clinically assessed (TCGA 2014). We now report responses to the MET inhibitors crizotinib and cabozantinib in patients with stage IV lung adenocarcinomas harboring mutations leading to MET exon 14 skipping.
Methods:
Patients with stage IV lung adenocarcinomas harboring MET exon 14 splice site mutations (N=6) or a mutation deleting Y1003 in exon 14 (N=1) were identified through a clinical assay based on hybrid capture/next-generation sequencing of 341 oncogenes and tumor suppressors (MSK-IMPACT). MET IHC was performed on archival FFPE tissue. RNA skipping was confirmed by NanoString. Radiographic response to MET inhibition was assessed using RECIST 1.1 and PERCIST criteria.
Results:
Clinicopathologic data for those treated (N=4) are in the table below:
To date, 3 patients have been treated with off-label crizotinib and 1 with cabozantinib (NCT01639508). Three of four patients (75%) developed a PR to treatment. The remaining patient had SD by RECIST, with PET imaging demonstrating a complete PERCIST response to treatment.ID Age Sex Smoking status (pack years) MET exon 14 variant MET therapy Response MET IHC (H-score) 1 65 M C (20) MET p.V1001_F1007del (c.3001_3021delGTAGACTACCGAGCTACTTTT) crizotinib (3rd line) PR (-31%) NA 2 80 M F (20) MET c.3024_3028delAGAAGGTATATT crizotinib (3rd line) PR (-30%) 300 3 90 F N MET c.3028G>C crizotinib (3rd line) PR (-47%) NA 4 80 F N MET c.3028G>C cabozantinib (3rd line) SD (0%), CR (PERCIST) 300
Conclusion:
MET exon 14 skipping is a novel oncogenic target that predicts for response to MET inhibitors. This appears to be a substantially better predictor of response than either protein expression or gene amplification. Patients with these splice site mutations should be treated on a clinical trial of a MET inhibitor. For those without access to a trial, use of off-label crizotinib should be considered.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
ORAL03.08 - Discussant for ORAL03.05, ORAL03.06, ORAL03.07 (ID 3293)
12:01 - 12:11 | Author(s): R. Salgia
- Abstract
- Presentation
Abstract not provided
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
Author of
-
+
MINI 16 - EGFR Mutant Lung Cancer 2 (ID 130)
- Event: WCLC 2015
- Type: Mini Oral
- Track: Treatment of Advanced Diseases - NSCLC
- Presentations: 1
- Moderators:G.J. Riely, M.C. Garassino
- Coordinates: 9/08/2015, 16:45 - 18:15, Four Seasons Ballroom F3+F4
-
+
MINI16.09 - Design, Execution, and Preliminary Biomarker Results from Paired Tumor Biopsy Cohorts of the AZD9291 AURA Trial (ID 941)
17:30 - 17:35 | Author(s): F. Blackhall
- Abstract
Background:
Epidermal growth factor receptor (EGFR)-mutant non-small cell lung cancer (NSCLC) exhibits sensitivity to EGFR tyrosine kinase inhibitors (TKIs) such as erlotinib and gefitinib; however, acquired resistance eventually develops in most patients. The most common mechanism of TKI resistance is a second-site mutation in the EGFR kinase domain, T790M. AZD9291 is an oral, potent, irreversible EGFR-TKI with potency against both T790M resistance and sensitizing EGFR mutations. In the ongoing Phase I AURA study (NCT01802632), AZD9291 induced durable responses in patients with acquired resistance to EGFR-TKIs. We report results of paired biopsy cohorts of the AURA trial, reviewing modulation of key molecular biomarkers of AZD9291 activity in patient tumor samples.
Methods:
Two cohorts of patients on the AURA trial were consented for collection of paired tumor biopsies. These patients had a pre-study tumor biopsy with T790M positive tumor status confirmed by central laboratory EGFR testing (Cobas™ EGFR Mutation Test). Following 8 to 15 days of once daily AZD9291 treatment (80 or 160 mg), a post-dose tumor biopsy was obtained. Baseline and post-dose tumor tissue was processed for routine histology and pathologic evaluation. More than 100 viable tumor cells per sample were required for subsequent biomarker scoring. Formalin-fixed paraffin-embedded tumor biopsies were profiled by immunohistochemistry with a suite of key pathway and tumor-relevant markers (phospho[p]-EGFR, pERK, pAKT, pS6, PD-L1, CD8). Matching plasma pharmacokinetic samples were also obtained for PK-PD correlations.
Results:
As of February 2015, 58 potential patients with an evaluable baseline biopsy were identified as candidates for post-dose biopsy collection. Sixteen of these patients did not proceed to an on-study biopsy as the identified lesions had regressed too substantially or were no longer considered suitable for re-biopsy, one patient was medically excluded from re-biopsy, and one patient’s sample was not available. In total, 40 patients supplied matched pre- and on-treatment biopsies. As of March 2015, paired tumor samples were available for QC from 26 of these 40 patients. Ten of these 26 biopsy specimens subsequently failed QC due to inadequate tumor content, leaving 16 paired tumor samples available for biomarker analyses, of which five have thus far been evaluated. AZD9291 treatment resulted in the inhibition of EGFR pathway components in the majority of post-treatment tumor biopsies. Tissue biomarker analyses are ongoing and updated data on evaluable biopsy pairs will be reported at the time of the congress.
Conclusion:
The completion of a paired biopsy cohort within the AURA trial was challenging due to the rapid onset of anti-tumor effects of AZD9291. Approximately 29% (17/58) of potentially eligible patients were unsuitable for the post-dose biopsy procedure due to tumor regression and 38% (10/26) of available post-dose biopsies were found to contain too little tumor for analysis. In the evaluable tumor pairs, pharmacodynamic modulation of the EGFR pathway was evident. Further biomarker analyses, including evidence of modulation of immune system markers, may help inform future combination strategies.
-
+
MINI 22 - New Technology (ID 134)
- Event: WCLC 2015
- Type: Mini Oral
- Track: Biology, Pathology, and Molecular Testing
- Presentations: 1
-
+
MINI22.12 - Molecular Characterisation of SCLC Using Both Circulating Tumour DNA and Circulating Tumour Cells Isolated from the Same Whole Blood Sample (ID 251)
17:50 - 17:55 | Author(s): F. Blackhall
- Abstract
- Presentation
Background:
Small Cell Lung Cancer (SCLC) is an aggressive, highly metastatic disease with dismal prognosis. Response rates to first line chemotherapy are generally high, but progression free survival is short due to development of chemotherapy resistance via mechanisms not well understood. Due to the difficulty in collecting tissue biopsies in SCLC, blood, which can be sampled simply and routinely, provides a means of inferring the current genetic status of a patients tumour via analysis of circulating tumour cells (CTCs) or circulating tumour DNA (ctDNA). These offer a minimally invasive opportunity to study drug resistance mechanisms, evaluate tumour heterogeneity and potentially reveal new drug targets in this disease. However, accurate assessment of both CTCs and ctDNA requires all blood cells be maintained intact until samples are processed, particularly when analytes present are at very low concentrations. Here we describe and validate a blood collection protocol that does not require on-site processing, and which is amenable for analysis of both CTCs and ctDNA following storage at ambient temperature in CellSave vacutainers for up to 96 hours after blood collection.
Methods:
To evaluate the suitability of using CellSave preserved samples for circulating free DNA (cfDNA) analysis, we undertook a 20 healthy normal volunteers (HNV) study and 45 patient sample study, with parallel EDTA and CellSave bloods collected. For each sample cfDNA was isolated between 4 hours and 96 hours post-draw and cfDNA yields determined. A potential issue with using CellSave blood was that the CellSave preservative could act as a DNA damaging agent and effectively increase background sequencing errors. To test this, the EDTA and CellSave cfDNA samples were subjected to next generation sequencing (NGS) to estimate the overall mutation burden. In addition, the utility of CellSave ctDNA for targeted NGS was also determined. Finally, SCLC-specific copy number aberrations (CNA) were analysed in ctDNA and CTCs isolated from the same CellSave blood sample from individual SCLC patients.
Results:
We demonstrate that yields of cfDNA obtained from 96-hour whole blood CellSave samples are equivalent to those obtained from conventional EDTA plasma processed within 4 hours of blood draw. Targeted and genome-wide NGS revealed comparable DNA quality and resultant sequence information from cfDNA within CellSave and EDTA samples, thereby validating CellSave blood as a viable source of ctDNA. We also demonstrate that CTCs and ctDNA can be isolated from the same patient blood sample, and give the same patterns of CNA allowing direct comparison of the genetic status of patients’ tumours.
Conclusion:
In summary, we have demonstrated the suitability of whole blood CellSave samples for both CTC and ctDNA molecular analysis in SCLC. The ability to generate informative molecular profiles of both CTCs and ctDNA from a simple whole blood sample, up to 4 days post-draw represents a significant methodological improvement for clinical benefit. We posit that as minimally invasive, liquid biopsies become increasingly employed for cancer patient management, the ability to routinely and simply draw blood and ship samples to accredited biomarker assessment laboratories will greatly facilitate the delivery of personalised cancer medicines.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
MINI 31 - ALK (ID 158)
- Event: WCLC 2015
- Type: Mini Oral
- Track: Treatment of Advanced Diseases - NSCLC
- Presentations: 2
- Moderators:S. Malik, I. Ou
- Coordinates: 9/09/2015, 18:30 - 20:00, Mile High Ballroom 1a-1f
-
+
MINI31.04 - Intracranial Efficacy of First-Line Crizotinib vs. Chemotherapy in ALK-Positive NSCLC (ID 1238)
18:45 - 18:50 | Author(s): F. Blackhall
- Abstract
- Presentation
Background:
The ongoing multicenter, randomized, open-label phase III study PROFILE 1014 recently demonstrated superior efficacy of crizotinib compared with chemotherapy in patients with previously untreated advanced ALK-positive NSCLC (Solomon et al, N Engl J Med 2014). Intracranial efficacy of crizotinib vs. chemotherapy was compared prospectively in this trial.
Methods:
Patients with previously untreated advanced non-squamous ALK-positive NSCLC (N=343) were randomized 1:1 to receive crizotinib 250 mg orally BID (n=172) or intravenous chemotherapy (pemetrexed 500 mg/m[2 ]+ cisplatin 75 mg/m[2] or carboplatin at AUC 5–6; all q3w for ≤6 cycles; n=171). Patients with treated brain metastases that were stable for ≥2 weeks with no ongoing requirement for corticosteroids were eligible. Treatment was continued until PD. Continuation of, or crossover to, crizotinib after PD (per independent radiology review [IRR]) was allowed for patients randomized to crizotinib or chemotherapy, respectively. Brain scanning was performed every 6 weeks in patients with baseline brain metastases and every 12 weeks in those without baseline brain metastases. Protocol-specified efficacy endpoints included PFS (primary endpoint), ORR, OS, and 12- and 18-month OS, as well as intracranial TTP. Intracranial DCR at 12 and 24 weeks was also evaluated. Efficacy was evaluated in the ITT population and in two subgroups of patients: those with and without baseline brain metastases.
Results:
Of 343 patients in the ITT population, 79 had brain metastases at baseline identified by IRR (23%) and 263 did not (77%; data not reported for one patient). Baseline characteristics of patients randomized to receive crizotinib or chemotherapy were generally well balanced within these two patient subgroups. Among the patients with baseline brain metastases, a significantly higher proportion achieved intracranial disease control with crizotinib than with chemotherapy at 12 weeks (33/39 [85%] vs. 18/40 [45%], respectively; P=0.0003) and at 24 weeks (22/39 [56%] vs. 10/40 [25%]; P=0.006). There was a numerical improvement in prospectively measured intracranial TTP with crizotinib in the ITT population (HR 0.60, P=0.069), as well as in patients either with baseline brain metastases (HR 0.45, P=0.063) or without baseline brain metastases (HR 0.69, P=0.323). The frequency of progression in the brain was low in the ITT population (15%) and in patients with and without baseline brain metastases (27% and 11%, respectively). Overall PFS was significantly longer with crizotinib than with chemotherapy in both subgroups (brain metastases present: HR 0.40, P=0.0007, median 9.0 vs. 4.0 months; brain metastases absent: HR 0.51, P≤0.0001, median 11.1 vs. 7.2 months), as it was in the ITT population (HR 0.45, P<0.0001, median 10.9 vs. 7.0 months). Twenty-five patients in the crizotinib arm of the study experienced intracranial PD; 22 of these patients received crizotinib for ≥3 weeks beyond PD and 19 also received intracranial radiotherapy.
Conclusion:
In this prospective assessment of intracranial efficacy, crizotinib demonstrated significantly greater intracranial disease control and overall efficacy compared with chemotherapy in patients with baseline brain metastases. These findings provide further confirmation of crizotinib as the standard of care for patients with previously untreated advanced ALK-positive NSCLC, including those patients with brain metastases at baseline.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
MINI31.12 - Quality of Life for Crizotinib vs. Chemotherapy in Asian ALK-Positive NSCLC Patients (ID 845)
19:35 - 19:40 | Author(s): F. Blackhall
- Abstract
- Presentation
Background:
PROFILE 1014 compared the efficacy and safety of the ALK inhibitor crizotinib with platinum based chemotherapy in previously untreated advanced ALK-positive advanced NSCLC (Pfizer; NCT01154140). The primary endpoint was progression-free survival. The main objective of this post-hoc analysis was to compare patient-reported symptom and global quality of life (QOL) between crizotinib and chemotherapy in the subgroup of patients of Asian ethnicity in the ongoing study PROFILE 1014.
Methods:
Patients in the ongoing PROFILE 1014 study were randomized to crizotinib (250 mg PO bid; n= 172) or chemotherapy (pemetrexed 500 mg/m[2] + either cisplatin 75 mg/m[2] or carboplatin AUC 5–6; all IV q3w for ≤6 cycles; n= 171). Patient-reported outcomes were assessed at baseline, day 7 and day 15 of cycle 1, day 1 of subsequent 3-week cycles and end of treatment using the validated cancer specific questionnaire EORTC QLQ-C30 and its lung cancer module QLQ-LC13. Validated translations of the questionnaires in Asian languages (Japanese, Chinese, Korean etc) were made available. Higher scores (range 0−100) indicated higher symptom severity or better functioning/QOL. A positive change from baseline score indicates improvement for global QOL/functioning and deterioration in symptoms. Repeated measures mixed-effects analyses were performed to compare change from baseline scores between the treatment arms, with no adjustments made for multiple comparisons.
Results:
Of 343 patients randomized, 46% were of Asian ethnicity (crizotinib, n=77; chemotherapy, n=80). Completion rates at baseline were ≥95% in each group and scores were balanced. A statistically significantly greater overall improvement from baseline was observed with crizotinib compared with chemotherapy for global QOL (5.6 vs -7.7; p<0.001), emotional functioning (9.5 vs 2.7;p<0.05), physical functioning (5.0 vs - 2.7 p<0.001) and role functioning (3.7 vs. -7.2;p<0.001). A statistically significantly greater overall improvement was observed with crizotinib compared with chemotherapy for cough (-17.3 vs. -11.2; p<0.05), dyspnea (-9.5 vs.-1.1; p<0.001), pain in arm or shoulder (-11.4 vs.-2.2; p<0.001), pain in chest (-7.3 vs.3.3; p<0.001), pain in other parts (-11.2 vs. -0.4;p<0.001), fatigue (-9.9 vs. 3.9; p<0.001), insomnia (-10.3vs. -2.0; p<0.05), pain (-12.2 vs.-1.2; p<0.001) and appetite loss (-5.3 vs. 5.7; p<0.001). A statistically significantly greater overall deterioration was observed in the crizotinib arm for diarrhea (12.6 vs. 2.4; p<0.001) compared with chemotherapy. No statistically significant differences were observed for social functioning, sore mouth, dysphagia, nausea & vomiting, constipation and alopecia between crizotinib and chemotherapy.
Conclusion:
Consistent with previously reported results in the overall study population, treatment with crizotinib showed statistically significantly greater overall improvement in patient-reported lung cancer symptoms and global QOL compared with chemotherapy in the subgroup of patients of Asian ethnicity with previously untreated advanced ALK-positive NSCLC.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
MS 07 - SCLC Biology & Models (ID 25)
- Event: WCLC 2015
- Type: Mini Symposium
- Track: Biology, Pathology, and Molecular Testing
- Presentations: 1
- Moderators:D. Carney, C.M. Rudin
- Coordinates: 9/07/2015, 14:15 - 15:45, Mile High Ballroom 4a-4f
-
+
MS07.05 - Circulating Tumour Cells (ID 1876)
15:20 - 15:35 | Author(s): F. Blackhall
- Abstract
- Presentation
Abstract:
Circulating Tumour Cells Dr Fiona Blackhall and Professor Caroline Dive Progress in understanding the molecular biology of small cell lung cancer has undoubtedly been hampered by lack of tissue resources suitable for comprehensive systems biology analysis. Tissue quantities sufficient for molecular analysis are more commonly from surgical resections and open biopsies from patients with very limited stage disease and therefore not representative of the majority of SCLC patients. Serial biopsies are even rarer to obtain. As an alternative to tumour tissue, circulating tumour cells (CTCs) are highly prevalent and abundant in patients with SCLC. These surrogate biomarkers, increasingly referred to as ‘virtual’ or ‘liquid’ biopsies, may be more relevant to understanding the biology of this disease that is hallmarked by early and widespread haematogenous dissemination. In our own series (Hou et al. JCO 2012) blood samples from 97 treatment naive patients, 31 with limited stage (LS) and 66 with extensive stage (ES), were assessed for CTCs using the EpCam-based immunomagnetic detection method, CellSearch. CTCs were detectable in the majority (85%) of patients and abundant. The mean ± standard deviation for CTC number(#) in a 7.5ml blood sample was 1,589 ± 5,565 and median CTC# was 24 (range 0 – 44, 896). CTC# was significantly associated (higher) with ES, lactate dehydrogenase, presence of liver metastases and number of sites of metastases. In multivariate analysis, adjusting for these clinical associations, pretreatment CTC# and change in CTC# after one cycle of chemotherapy were independent prognostic factors. A statistically derived cut off of 50 CTCs demonstrated most significant discrimination in survival estimation. The overall survival was 5.4 months for patients with ≥ 50 CTCs/7.5 mL of blood compared with 11.5 months (P < .0001) for patients with less than 50 CTCs/7.5 mL of blood before chemotherapy (hazard ratio = 2.45; 95% CI, 1.39 to 4.30; P =0 .002). In addition to prognostic information CTCs are pharmacodynamic and amenable to biomarker assay development (protein expression, omic profiling, FISH etc). CTCs ex vivo are also tumourigenic. We have established a series of CTC derived xenografts (CDX) in immune compromised (IC) mice (Hodgkinson et al. Nat Med 2014). Of 6 initial patients whose CTCs were implanted in IC mice, 4 gave rise to tumours in less than 5 months. Implantation and CDX tumour formation was associated with higher CTC# (>400 CTCs / 7.5mls of blood). The immunohistochemical characteristics of the CDX tumours were consistent with SCLC morphology and neuroendocrine marker expression. Whole genome sequencing demonstrated that the tumours had mutations (e.g. TP53 and RB1) and copy number variation (e.g. loss of 3p and 13q) commonly observed in SCLC. Furthermore, the same genetic abnormalities as the CDX were present in single cells CTCs isolated from the corresponding patient. On exposure of the CDX to platinum and etoposide chemotherapy a remarkable correlation was observed for the tumour responses compared to the patients’ tumour responses and survival. For example the most chemoresistant CDX was established from CTCs of a patient who survived for only 0.9 months and who had chemorefractory disease, whereas the most chemosensitive CDX was obtained from a patient who responded to platinum/etoposide chemotherapy and who survived for 9.7 months. A CDX of intermediate chemosensitivity was derived from a patient who survived for 3.5 months. Once the CDX tumours are established they can be harvested for passage, frozen and resurrected. Ongoing work aims to establish serial CDX models from patients who have progressed after initial treatment for study of biology, particularly that of acquired chemoresistance, and for preclinical testing of novel therapeutics in treatment naïve and previously treated SCLC. There is also possibility to incorporate serial CTC analysis and CDX model generation into clinical trials as ‘co-clinical trials’ with interrogation of pharmacodynamic and putative predictive biomarkers in addition to discovering mechanisms of resistance to novel therapeutics. CTC analysis and CDX model generation are technically challenging and resource intensive, but essential tools to further develop if we are to end the impasse on a targeted therapy breakthrough for this disease. References Hou JM, Krebs MG, Lancashire L, Sloane R, Backen A, Swain RK, Priest LJ, Greystoke A, Zhou C, Morris K, Ward T, Blackhall FH, Dive C. Clinical significance and molecular characteristics of circulating tumor cells and circulating tumor microemboli in patients with small-cell lung cancer. J Clin Oncol. 2012 Feb 10;30(5):525-32. Hodgkinson CL, Morrow CJ, Li Y, Metcalf RL, Rothwell DG, Trapani F, Polanski R, Burt DJ, Simpson KL, Morris K, Pepper SD, Nonaka D, Greystoke A, Kelly P, Bola B, Krebs MG, Antonello J, Ayub M, Faulkner S, Priest L, Carter L, Tate C, Miller CJ, Blackhall F, Brady G, Dive C. Tumorigenicity and genetic profiling of circulating tumor cells in small-cell lung cancer. Nat Med. 2014 Aug;20(8):897-903.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
ORAL 25 - Biology and Other Issues in SCLC (ID 125)
- Event: WCLC 2015
- Type: Oral Session
- Track: Small Cell Lung Cancer
- Presentations: 1
- Moderators:J. Sage, L. Montuenga
- Coordinates: 9/08/2015, 10:45 - 12:15, 605+607
-
+
ORAL25.02 - Vasculogenic Mimicry in Small Cell Lung Cancer (ID 2654)
10:56 - 11:07 | Author(s): F. Blackhall
- Abstract
Background:
Small cell lung cancer (SCLC) accounts for 15-20% of lung cancer cases worldwide and is characterised by early dissemination. Despite initial responses to chemotherapy, most patients relapse with drug resistant disease and long term survival is rare. Targeting tumour vasculature in SCLC with anti-angiogenic drugs produced disappointing results. However, angiogenesis-independent tumour vascularisation including vasculogenic mimicry (VM), warrant further investigation. VM describes the ability of aggressive tumour cells with ‘stem-like’ plasticity to adopt endothelial characteristics and form fluid conducting channel-like structures independent of host vasculature. We sought to determine the prevalence of VM in SCLC and explore associations of VM with chemotherapy sensitivity and patient outcomes. We investigated the role of a VM-associated protein, VE-Cadherin in vitro and in vivo and in SCLC CTCs. We are testing the hypothesis that VM may contribute to the high prevalence of CTCs in SCLC and components of the VM pathway may be targets for SCLC therapeutics.
Methods:
VM was evaluated using CD31/periodic acid-Schiff (PAS) staining in a tissue micro-array (TMA) from 41 limited stage SCLC chemo-naive patients and in tumours from 11 Circulating Tumour Cell (CTC) Derived Explant (CDX) models (Hodgkinson et al Nature Medicine, 2014). The relative abundance of VM channels (CD31-ve/PAS+ve) compared to host derived blood vessels (CD31+ve/PAS+ve), (VM/total vessels) in the TMA was compared to patient overall survival (OS). VM was evaluated in vitro by network formation in Matrigel (Hendrix et al., PNAS 2001) in a panel of SCLC cells lines and in H446 cells where VE-Cadherin was knocked down with shRNA. H446 cells +/- VE-Cadherin were grown in vivo as xenografts and evaluated for VM. ISET filtered, DAPI stained CTCs were immune-stained for CD45, cytokeratin and VE-cadherin and a VM score was generated.
Results:
In the TMA, a VM/Total Vessels score >10% was a poor prognostic factor for OS by univariate (p=0.011) and multivariate (p=0.014) analyses. VM was present in all CDX models provide surrogate tissues in which to study VM. Of 12 SCLC cell lines studied, H446 showed significant VE-Cadherin expression and formed networks in Matrigel; VE-Cadherin shRNA abrogated this network formation. Similarly, a pilot in vivo study demonstrated that there were fewer VM vessels when VE-Cadherin was reduced. In CTC samples 37/38 chemonaive SCLC patients contained a sub-population of VE-Cadherin expressing CTCs where the VM score ranged from 0 – 100% (median 11%, mean 21%).
Conclusion:
We present the first evidence of VM in SCLC which correlates with poor OS consistent with findings in other cancer types. VE-Cadherin is required in SCLC for VM network formation in vitro and preliminary data indicate that VE-Cadherin influences VM in vivo. Furthermore, VE-Cadherin and pan-cytokeratin co-expression was found in SCLC CTC sub-populations. We are investigating the role of VE-Cadherin in VM in SCLC and are exploring the hypotheses that VE-cadherin and VM may play a role in drug delivery and/or sensitivity and may represent an aggressive, ‘stem-like’ population that may contribute to dissemination and relapse in this highly aggressive disease.
-
+
ORAL 37 - Novel Targets (ID 146)
- Event: WCLC 2015
- Type: Oral Session
- Track: Biology, Pathology, and Molecular Testing
- Presentations: 1
- Moderators:S.S. Ramalingam, E. Thunnissen
- Coordinates: 9/09/2015, 16:45 - 18:15, Mile High Ballroom 4a-4f
-
+
ORAL37.05 - Prevalence and Clinical Association of MET Gene Amplification in Patients with NSCLC: Results from the ETOP Lungscape Project (ID 444)
17:28 - 17:39 | Author(s): F. Blackhall
- Abstract
Background:
The reported prevalence of MET gene amplification in non-small cell lung cancer (NSCLC) varies from 0-21% and clinical correlations are emerging slowly. In a well-defined NSCLC cohort of the ETOP Lungscape program, we explore the epidemiology, the natural history of MET amplification and its association with MET overexpression, overall survival (OS), relapse-free survival (RFS) and time to relapse (TTR).
Methods:
Resected stage I-III NSCLC, identified based on the quality of clinical data and FFPE tissue availability, were assessed for MET gene copy number (GCN) and expression analysis using silver in-situ hybridization (SISH) and immunohistochemistry (IHC), respectively, on TMAs (MET and centromere-specific probes; anti total c-MET antibody, clone SP44; Ventana immunostainer). MET amplification was defined as MET/centromere ratio ≥2 with average MET GCN ≥4, high MET GCN at two levels as ≥median CGN and ≥5 (irrespective of amplification) and MET IHC+ as 2+ or 3+ intensity in ≥50% of tumor cells. Sensitivity analysis to define the amplification’s thresholds was also performed. All cases were analysed at participating pathology laboratories using the same protocol, after successful completion of an external quality assurance (EQA) program.
Results:
Currently 2709 patients are included in the Lungscape iBiobank (median follow-up 4.8 years, 53.3% still alive). So far, 1547 (57%) have available results for MET GCN with amplification detected in 72 (4.7%; 95%CI: 3.6%, 5.7%) and high MET GCN (≥5) in 65 (4.2%; 95%CI: 3.2%, 5.2%). The median value of average MET GCN per cell is 2.3. IHC MET expression is available for 1515 (98%) of these cases, 350 (23%) of which are MET IHC positive [170 cases (49%) 3+, 180 (51%) 2+]. The median age, for the cohort of 1547 patients, is 66.2 years, with 32.8% women, and 13.5%, 29.7%, 54% never, current, former smokers, respectively. Stage distribution is: IA 23.6%, IB 24.6%, IIA 17%, IIB 12.1%, IIIA 20.9%, IIIB 1.8%, while 52.7%, are of adenocarcinoma and 40.0% of squamous histology. MET amplification and high MET GCN (≥5) are not significantly associated with any histological tumor characteristics or stage (multiplicity adjusted alpha: 0.005). High MET GCN (≥2.3) is less frequent in current smokers (38.3% vs. 55.6% for former or non-smokers, p<0.001). MET amplification and high MET GCN are significantly associated with IHC MET positivity (p<0.001 in all cases). MET amplification is present in 9.7% of IHC MET+ vs 3.1% of IHC MET- patients and high MET GCN (≥5) in 8.6% of IHC MET+ vs 2.8% of IHC MET- patients. MET amplification ranges from 0 to 16% between centers, while high MET GCN (≥5) and (≥2.3) from 0% to 12%, and 11.8% to 98.9%, respectively. MET amplification and both levels of high MET GCN are not associated with OS, RFS or TTR.
Conclusion:
The preliminary results for this large, predominantly European, multicenter cohort demonstrate that MET amplification assessed by SISH prevails in 4.7% of NSCLC, is associated with strong MET expression, and has no influence on prognosis. The large inter-laboratory variability in GCN despite EQA efforts may highlight a critical challenge of MET SISH analysis in routine practice.
-
+
P3.01 - Poster Session/ Treatment of Advanced Diseases – NSCLC (ID 208)
- Event: WCLC 2015
- Type: Poster
- Track: Treatment of Advanced Diseases - NSCLC
- Presentations: 1
- Moderators:
- Coordinates: 9/09/2015, 09:30 - 17:00, Exhibit Hall (Hall B+C)
-
+
P3.01-079 - Addition of Hsp27 Inhibitor Apatorsen to First-Line Gemcitabine/Carboplatin in Advanced Squamous Cell Lung Cancer: Design of the Cedar™ Trial (ID 2169)
09:30 - 09:30 | Author(s): F. Blackhall
- Abstract
Background:
Outcomes remain poor in patients with non-small cell lung cancer (NSCLC) of squamous origin. There are few established therapeutic targets, and benefits of chemotherapy are frequently short-lived, with rapid development of treatment resistance. More effective therapies are urgently required. Substantial preclinical data demonstrate that heat shock protein 27 (Hsp27) affects numerous pathways implicated in cancer progression and treatment resistance. Approximately 70-98% of squamous-cell tumours express Hsp27. Apatorsen (OGX-427) is a second generation antisense oligonucleotide that effectively down-regulates Hsp27 in vitro and in vivo; clinical studies are evaluating apatorsen in lung, bladder, prostate, and pancreatic cancers.
Methods:
The phase 2, UK, investigator led, randomized, open-label trial Cedar trial was initiated in July 2014. Eligible patients have confirmed Stage IIIB/IV squamous cell lung cancer and no prior chemotherapy for advanced disease, with ECOG score of 0-2 and adequate bone marrow, renal, and liver function; patients with known EGFR mutation or ALK rearrangements are excluded. Planned enrollment is 140 patients; randomization (1:1) is stratified by stage and performance status. Patients receive 21-day cycles of gemcitabine (1250 mg/m[2]) and carboplatin (AUC5) or gemcitabine/carboplatin plus apatorsen (600 mg IV/wk, preceded by 3 doses during a 9-day loading period) for up to 6 cycles. Tumor evaluation occurs q6 wks. Patients randomized to apatorsen may continue weekly single agent maintenance until progressive disease (PD), unacceptable toxicity, or withdrawal of consent. The primary efficacy measure is progression-free survival. Secondary efficacy measures include objective response (OR), change in tumour size at 12 wks, clinical benefit rate, duration of OR/clinical benefit, overall survival, and proportion without PD at 12 and 24 wks. Efficacy analyses are intent-to-treat. Adverse events and laboratory results are assessed, and interim safety analyses are planned. Pre-specified subset analyses will characterize the relevance of Hsp27 expression in tumour and blood samples.
Results:
Not applicable.
Conclusion:
Not applicable.
-
+
P3.04 - Poster Session/ Biology, Pathology, and Molecular Testing (ID 235)
- Event: WCLC 2015
- Type: Poster
- Track: Biology, Pathology, and Molecular Testing
- Presentations: 1
- Moderators:
- Coordinates: 9/09/2015, 09:30 - 17:00, Exhibit Hall (Hall B+C)
-
+
P3.04-009 - Evaluation of RT-PCR Methodology for ALK Assessment in Patients with NSCLC in Europe: Results from the ETOP Lungscape Project (ID 1506)
09:30 - 09:30 | Author(s): F. Blackhall
- Abstract
Background:
ALK rearrangement is documented in 2%-7% of NSCLC, depending on the population studied and detection method used. Although the reverse transcriptase-polymerase chain reaction (RT-PCR) was the first used and published method, fluorescence in situ hybridization (FISH) has become the primary standard diagnostic method. Recently, immunohistochemistry (IHC) has also proven to be a reproducible, faster and sensitive technique. This is one of the first studies concurrently comparing all three techniques in resected lung adenocarcinomas from the large ETOP Lungscape cohort.
Methods:
95 cases from the ETOP Lungscape iBiobank, selected based on any degree of IHC staining (clone 5A4 antibody, Novocastra, UK), were examined by ALK FISH (Abbott Molecular, Inc.; Blackhall, JCO 2014) and central RT-PCR. For the latter, formalin-fixed, paraffin-embedded (FFPE) unstained slides were collected from participating centers. Slides were de-paraffinized, Toluidine Blue stained, and tumors macro-dissected. Tissue digestion and RNA extraction were performed (Qiagen RNeasy FFPE Kit). Using primers described in the literature covering most of ALK known translocations, RT-PCR (Superscript One-Step RT-PCR with Platinum Taq – 40 loops) was performed, followed by capillary electrophoresis in two separate mixes. Co-amplification of B-actin was done to validate the procedure and RNA quality. All tests were duplicated.
Results:
76 of 95 RT-PCR had adequate RNA quality (B-actin co-amplification present). Among these, 18 were FISH positive, 16 were RT-PCR positive, including EML4-ALK V3a/b in 7, V1 in 5, V2 in one, and undetermined variants in 3 cases. 53 of 54 FISH negative cases were also RT-PCR negative (98%). 15 of 18 FISH positives harbored a translocation by RT-PCR (83%). Among the 4 discrepant cases, 2 FISH+/RT-PCR- cases had IHC H-scores of 180 and 260, and 98.3% and 95% of rearranged cells by FISH, probably corresponding to variants not covered by the RT-PCR. One had an IHC H-score of 5, and 16% cells rearranged on FISH, most probably corresponding to a FISH false positive case. The last had an IHC H-score of 200, 13% rearranged cells by FISH, and, thus is defined as a false negative FISH result. Provided IHC is defined as positive by an H-score above 120, all but one case (H-Score 20, FISH and RT-PCR positive) gave concordant results by a combination of FISH and RT-PCR. Overall, using as true negative or true positive the concordant result of two of the methods, the third method is characterized by high specificity and sensitivity with corresponding values of 100/98/100% and 94/94/89% for IHC/FISH/RT-PCR, respectively.
Conclusion:
RT-PCR is a very good tool for sorting discordant IHC/FISH cases, however, we do not recommend using this technique as single method due to the lower sensitivity of RT-PCR, as not all variants are covered, and also due to the limitations with RNA preservation.
