Virtual Library

Background:
Lung cancer remains the leading cause of cancer mortality in United States and globally. Pemetrexed combined with platinum chemotherapy is specifically indicated for treatment of non-squamous non-small cell lung cancer (non-sq NSCLC). Pemetrexed is a folate-analog metabolic inhibitor that disrupts folate-dependent processes essential for cell replication. Pemetrexed inhibits thymidylate synthase (TS), dihydrofolate reductase (DHFR), and glycinamide ribonucleotide formyltransferase (GARFT), which are folate-dependent enzymes involved in the de novo biosynthesis of thymidine and purine nucleotides. Folate receptor alpha (FRalpha) is a folate/antifolate transporter protein that is overexpressed by a number of epithelial tumors. The purpose of this study is to identify proteomic biomarkers predictive of response to pemetrexed-based chemotherapy in non-sq NSCLC.

Methods:
Patients with advanced non-sq NSCLC who received pemetrexed-based chemotherapy at West Virginia University from 2009 to 2014 were retrospectively identified. Formalin-fixed, paraffin-embedded tumor biopsies were laser microdissected, solubilized, enzymatically digested and subjected to quantitative proteomic analysis. A multiplexed, selected reaction monitoring (SRM) mass spectrometry (MS) assay was used to determine the absolute levels of 46 different candidate proteomic markers, including those in the folate receptor pathway. The Kaplan-Meier method and log-rank test were used in statistical analysis of overall survival (OS) and progression-free survival (PFS).

Results:
The 74 patients included in the study had a median follow-up of 26 months, a median OS of 16.6 months (95%CI: 11.6 - 43.4), and a median PFS of 9.61 months (95%CI: 8.43, 12.98). There were 65 patients who received pemetrexed-based regimen as a first line therapy and 9 patients as subsequent salvage treatment. In a comparison between patients who survived >24 months and < 8 months, there were no significant differences between the two groups in terms of sex, age, ECOG performance status, TNM stage at diagnosis, and smoking history. Among the 37 patients with sufficient tumor specimens available for multiplexed proteomic analysis, 30 biomarkers were detected with varying levels of expression. Sixteen additional biomarkers were undetectable. TS protein expression was detected in only 2 patients. Patients whose tumors expressed low levels of GARFT protein (≤900 amol/µg; n=7) had statistically significantly longer median PFS than those whose tumors expressed high levels of GARFT (>900 amol/µg; n=30) (40.6 vs. 11.4 months; p= 0.014). Patients with high FRalpha protein expression (>1510 amol/µg, n=9) had significantly longer median PFS than those with low FRalpha expression (≤1510 amol/µg; n=28) (>50 vs. 11.4 months; p= 0.021). Moreover, the 23 patients with both high GARFT expression (>900 amol/µg) and low FRalpha expression (≤1510 amol/µg) faired considerably worse than the remainder of patients (median PFS 10.1 vs. 40.6 months; p=0.0003).

Conclusion:
Multiplexed mass spectrometry-based proteomics offers a feasible and promising approach for tumor biomarker profiling and quantification to predict therapeutic response. Of note, our results show that FRalpha and GARFT protein expression may be predictive of response to pemetrexed-based treatment in patients with non-sq NSCLC. Further investigation is needed to validate the utility of these biomarkers for guiding personalized treatment decisions in clinical practice.

Background:
A major challenge in the treatment of advanced non-small cell lung cancer (NSCLC) is to identify specific tumor properties that predict response to chemotherapy. Although thymidylate synthase (TS) immunohistochemical (IHC) staining has been extensively studied as a predictive marker for pemetrexed (PEM) sensitivity, its clinical value remains limited. We investigated IHC stainings of different molecular markers linked to the folate metabolic pathway (FMP) identified with gene expression profiling (Hou et al, JTO 2012;7:105-114). We used a population with advanced NSCLC treated with PEM for external validation.

Methods:
Resected tumor samples from PEM-naïve NSCLC patients were collected. Gene expression profiling with respect to predicted sensitivity to PEM was based on genes related to FMP. Based on differentially expressed genes, patients were divided into predicted responders (Rs) and non-responders (NRs). Genes showing a strong correlation with these FMP genes and for which IHC stainings were commercially available, were selected for measurement of corresponding protein expressions by IHC stainings. A semiquantitative scoring method was applied, which was used to construct a prediction model for response to PEM. Subsequently, a retrospective cohort of patients with advanced NSCLC was selected, who had received at least two cycles of PEM-based chemotherapy as first-line treatment. IHC staining scores for the same proteins were obtained from tumor tissue. The performance of the prediction model was tested in this population.

Results:
From 91 patients resected tumor samples were collected. The majority of patients had early or locally advanced NSCLC (96.3%). Gene expression profiling revealed five markers that showed mRNA levels strongly correlating to FMP genes mRNA levels: TPX2, CPA3, EZH2, MCM2 and TOPO2a. Of 63 patients IHC staining scores of these markers were obtained, which all correlated to their corresponding mRNA levels. The scores were significantly different between predicted NRs and Rs (p<0.05). Testing the IHC markers showed an optimized prediction model with CPA3 (OR=1.71, 95%CI (0.94-3.08)), EZH2 (OR=0.57, 95%CI (0.35-.093)) and TPX2 (OR=0.55, 95%CI (0.29-1.03)) included. With this model 86.5% of the predicted Rs and 72.7% of the predicted NRs were correctly classified. The ROC showed an AUC of 0.883 representing a good discriminatory performance. In the external study population (n=23) the majority of patients had metastatic NSCLC (95.7%). Partial response (PR) was established in 26.1%. Considering patients with PR as responders the prediction model classified 16.7% of the observed Rs and 88.2% of the observed NRs correctly. The ROC showed an AUC of 0.750.

Conclusion:
Using external validation this prediction model with IHC staining of FMP correlated markers shows a good specificity, but lacks sensitivity. Again this study shows the limited value of IHC markers as response predictors for PEM in clinical practice. This may be ascribed to the poor relation between IHC and protein activity but the biological significance of FMP genes may also be less important than other factors influencing PEM activity, like pharmacodynamics of PEM e.g. the formation of metabolites. Metabolomics may offer better understanding in cellular processing of PEM and could provide new insights for tailored chemotherapy. Supported by an unrestricted grant from Eli-Lilly, the Netherlands

Abstract not provided

Background:
VeriStrat is a blood-based multivariate proteomic test that predicts response to second line epidermal growth factor receptor tyrosine kinase inhibitor (EGFR TKI) therapy in non-small cell lung cancer (NSCLC). We report a retrospective blinded analysis of VeriStrat classification in plasma samples from a phase 1b/2 trial of cabozantinib (C) +/- erlotinib (E) in metastatic NSCLC patients who had all progressed after benefiting from EGFR TKI therapy. Cabozantinib inhibits the MET/hepatocyte growth factor (HGF) pathway, and VeriStrat may be a surrogate marker for this pathway.

Methods:
Patients enrolled into phase 1b (1A:60 mg C+150 mg E, 2A:60 mg C+100 mg E, 3A:100 mg C+100 mg E, 4A:100 mg C+50 mg E, 2B:40 mg C+150 mg E) and phase 2 (Arm A:100 mg C, Arm B:100 mg C+50 mg E). EGFR mutation (EGFRm) status was tested on archival tissue and/or plasma when available. The primary objective was to determine if pre-treatment VeriStrat (VS) classification, good or poor, was prognostic for patients treated with cabozantinib +/- erlotinib. Kaplan-Meier method and log-rank test was used to compare progression-free survival (PFS) of VS-good v. VS-poor patients. Outcomes were stratified by EGFRm status (mutated v. wild type WT/unknown UNK).

Results:
Of 79 evaluable patients, 71 were classified as VS-good and 8 as VS-poor. 55.7% had an activating EGFRm (majority exon 19 del/exon 21 L858R) and 12.7% had UNK EGFRm status. There were no significant differences in patient characteristics between VeriStrat-groups. VS-good patients had a statistically improved PFS: VS-good 3.7 mo. (95% CI 3.5-5.4) v. VS-poor 1.9 mo. (95% CI 1.1-3.4), p=0.014. This was still true after excluding 14 patients who had received cabozantinib alone (p=0.005). There was no difference in PFS for VS-good patients when stratified by EGFRm status. There was also no difference in PFS for VS-poor patients with WT/UNK EGFR v. VS-good patients irrespective of EGFRm status. However, VS-poor patients with WT/UNK EGFR had improved PFS compared to VS-poor patients with an EGFRm (3.1 mo. v. 1.6 mo., HR 0.15, 95% CI 0.03-0.68).

Conclusion:
VeriStrat is a strong prognostic marker in this study. This study suggests cabozantinib neutralized the worse prognosis of VS-poor patients with WT/UNK EGFR. Given the heterogeneity of treatment dosing, the small number of VS-poor patients, and a high proportion of unknown EGFRm (including T790M) status, this analysis should be considered exploratory.

Background:
EML4-ALK is a new driver gene of non-small cell lung cancer (NSCLC) and is associated with response to inhibition with crizotinib. ALK break apart fluorescence in situ hybridization (FISH) assay, Ventana immunohistochemistry (IHC), and reverse transcriptase polymerase chain reaction (RT-PCR) can all be used as the primary assay for detecting ALK fusion events in tumor samples of lung cancer patients with SFDA approval in China. The objective of this study was to analyze the association of ALK rearrangements with clinical outcomes in different ALK testing methods, including FISH, Ventana IHC, and RT-PCR.

Methods:
ALK status was assessed by FISH, IHC and RT-PCR in 75 patients with advanced ALK-positive lung adenocarcinoma who had received crizotinib treatment from 2011, May to 2014, Nov in China. Clinicopathologic data and survival outcomes were analyzed. Kaplan-Meier cumulative probability was used to assess different testing methods for survival.

Results:
Of all 75 ALK-positive lung adonocarcinoma, there are 23 FISH-positive ALK patients (23/75, 30.7%), 35 IHC-positive ALK patients (35/75, 46.7%) and 17 RT-PCR-positive ALK patients (17/75, 22.7%). 75 patients received crizotinib treatment with IHC-positive and FISH-positive had better progression-free survival (PFS) (P=0.049, Fig A), compared with those with RT-PCR-positive, but not for overall survival (OS) (P=0.074). The median PFS survival for all these 75 patients was 16m, 14m, 8m, respectively, based on the IHC, FISH, and RT-PCR test (Fig A). 23 patients received first-line crizotinib treatment with IHC-positive and FISH-positive had better PFS (P=0.030), compared with those with RT-PCR-positive, but not for OS (P=0.061), either. The median PFS survival for these 23 patients with first-line crizotinib treatment was 12m, 18m, 4.8m, respectively, based on the IHC, FISH, and RT-PCR test. Of all 17 RT-PCR-positive ALK patients, there are 10 E13:A20 fusion type (10/17, 58.8%), 4 E6:A20 fusion type (4/17, 23.5%), 2 E18:A20 fusion type (2/17, 11.8%), and 1 E2:A20 fusion type (1/17, 5.9%). 4 different fusion-type ALK-positive patients detected by RT-PCR received crizotinib treatment with no crizotinib-related PFS significant difference (P=0.312) and no OS difference (P=0.149).Figure 1



Conclusion:
ALK-positive patients confirmed by IHC and FISH assay, compared with RT-PCR, maybe have better crizotinib-related PFS. RT-PCR method needs to be further evaluated in clinical practice to identify its role in guiding targeted therapy using crizotinib. And there is no survival difference for different ALK fusion type detected by RT-PCR in our cohort, which need further validation in a large group.

Background:
The Fibroblast Growth Factor Receptor(FGFR) pathway especially FGFR1 gene copy number gain have attracted continuous attention of researchers for several years. Whereas due to different test methods and distinguishing criteria whether FGFR1 amplification related to patients smoking status or prognosis is still controversial.

Methods:
We used fluorescence in situ hybridization (FISH) to detect the gene copy number in paraffin-embedded tissue sections from 200 cases of pulmonary squamous cell carcinoma patients who underwent surgery in Guangdong Lung Caner Institute(GLCL) from 2008 to 2013. All samples had been identified as primary squamous cell carcinoma by postoperative pathology and informed consent. A tumor is defined as FGFR1 amplification positive when FISH results meet one of the following criteria after reviewing at least 100 tumor cells: (1) FGFR1/CEP-8 ratio≥2; (2) mean number of FGFR1 signals≥6; or if (3) ≥10% tumor cell containing more than 15 FGFR1 signals or large clusters. Among them, sample accord with the 3rd standard was defined as focal amplification.

Results:
Figure 1 We used fluorescence in situ hybridization (FISH) to detect the gene copy number in paraffin-embedded tissue sections from 200 cases of pulmonary squamous cell carcinoma patients who underwent surgery in Guangdong Lung Caner Institute(GLCL) from 2008 to 2013. All samples had been identified as primary squamous cell carcinoma by postoperative pathology and informed consent. A tumor is defined as FGFR1 amplification positive when FISH results meet one of the following criteria after reviewing at least 100 tumor cells: (1) FGFR1/CEP-8 ratio≥2; (2) mean number of FGFR1 signals≥6; or if (3) ≥10% tumor cell containing more than 15 FGFR1 signals or large clusters. Among them, sample accord with the 3rd standard was defined as focal amplification.



Conclusion:
Our results suggested that FGFR1 focal amplification might be an independent risk factor for patients overall survival. Patients with FGFR1 amplification were more likely to disease recurrence. Clinical characteristic including smoking status were not found in association with FGFR1 amplification, suggesting patients with FGFR1 amplification might not be fully enriched through only clinical factors.

Abstract not provided

Background:
We have recently shown that VEGF, at least in part, is an autocrine growth factor for NSCLC cells, mediating its survival effects via VEGFR2 (KDR) in addition to the more novel receptor, Neuropilin-1 (Barr et al., Mol Cancer, 2015). In this study, we evaluated the potential therapeutic utility of histone deacetylase (HDAC) inhibitors in targeting the VEGF-VEGFR signalling axis in non-small cell lung cancer (NSCLC) cells.

Methods:
The effect of the HDAC inhibitor, Trichostatin-A (TSA) on modulating the expression of the VEGF receptors, VEGFR1, VEGFR2, NP1 and NP2, in A549 and SKMES-1 cells was examined and validated at the mRNA level and protein levels using RT-PCR and Western blot analysis. Gene expression was further validated by quantitative real-time PCR. To investigate the effect of TSA on the viability of NSCLC cells, these were treated with increasing concentrations of TSA (2.5 ng/ml-250 ng/ml) for 24h. Cell proliferation and apoptosis was measured by BrdU and Annexin V/PI (FACS), respectively. VEGF protein secretion in response to TSA was assessed in conditioned media from lung tumour cells by ELISA. To determine if the effects of TSA on VEGFR receptors were mediated through immediate to early responses, cells were pre-treated with cycloheximide (10 µg/ml) for 2 h followed by treatment with TSA (250 ng/ml) for 24 h. To confirm whether the observed effects of HDAC inhibition by TSA were due to increased histone hyperacetylation at the VEGFR1 and VEGFR2 gene promoters, chromatin immunoprecipitation (ChIP) analysis was carried out following treatment with TSA.

Results:
NP1 and NP2 mRNA levels were decreased in both A549 and SKMES-1 lung cancer cells in response to TSA and induced the expression of VEGFR1 and VEGFR2 at higher concentrations. TSA however, had no effect on VEGF mRNA expression. Critically, the effect of TSA was more marked at the protein level, with complete loss of Neuropilin-1 protein. HDAC inhibition resulted in a significant decrease in the viability of A549 and SKMES-1 cells in a dose-dependent fashion. While TSA induced significant apoptosis of both lung tumour cell lines, VEGF was unable to rescue cells from TSA-induced cell death. VEGF secretion was significantly decreased in both cell lines. Treatment with cycloheximide was unable to abrogate the TSA-mediated increase in the VEGF receptors examined, indicating that de novo protein synthesis is not required for these observed effects, but may be due to direct effects at the promoter level. Direct histone acetylation of histones H3 and H4 was observed, indicating an increase in histone hyperacetylation of VEGFR1 and VEGR2 promoters. A significant trend in the modulation of the VEGF receptors similar to that seen in response to TSA was shown when treated with Vorinostat (SAHA).

Conclusion:
Epigenetic targeting of the Neuropilin receptors may offer an effective treatment for NSCLC patients in the clinical setting. The possibility of novel targeted agents decreasing the levels, or function, of tumour VEGF receptors, in particular NP1, may lead to more successful treatments and prolonged overall survival in these patients.

Background:
Adenocarcinoma (AC) and Squamous Cell Carcinoma (SCC) constitute the commonest lung cancer histotypes, but current therapies still fail to significantly increase their survival rate. An effective immunotherapy to apply alternatively or together with specific treatments may be of great value. Here we asked whether Interleukin (IL)-27, which has revealed powerful antitumor activity in different tumor types and is toxicity-free in humans, is a promising therapeutic choice for NSCLC patients.

Methods:
Human lung AC and SCC cell lines were used to assess IL-27’s effect on cancer cell viability, by flow cytometry, and on malignancy-related gene expression, by qRT-PCR. Its effects on tumor growth were assessed in pre-clinical models and examined histopathologically. Expression of IL-27Receptor(R) in clinical samples was assessed by laser capture microdissection followed by qRT-PCR, and by immunohistochemistry.

Results:
In vitro, IL-27 was ineffective on cancer cell proliferation or apoptosis, but fostered CXCL3/GROg/MIP2b expression. In vitro and in vivo, IL-27 down-regulated stemness-related genes, namely SONIC HEDGEHOG in AC cells, and OCT4A, SOX2, NOTCH1, KLF4 along with the Epithelial to Mesenchymal Transition (EMT)-related genes NESTIN, SNAI1/Snail, SNAI2/Slug and ZEB1, in SCC cells. In vivo, IL-27 hampered both AC and SCC tumor growth in association with a prominent granulocyte- and macrophage-driven colliquative necrosis, CXCL3 production, and a reduced pluripotency- and EMT-related gene expression. Myeloablation of tumor-bearing hosts mostly abolished IL-27's antitumor effects. In clinical samples, IL-27R was expressed by the majority of AC, 90%, and SCC, 84%. Its expression by the primary tumor was significantly associated with advanced stages of disease (P = 0,02) as assessed by Fisher’s exact test. IL-27R was also expressed by pre-cancerous lesions, microvessels, and by infiltrating immune cells as CD15[+]granulocytes, CD68[+]monocytes/macrophages and CD11c[+]myeloid dendritic cells scattered in the stroma or within the lymph node–like structures, known as tertiary-lymphoid-structures (TLS).

Conclusion:
Altogether, our results highlight novel aspects of IL-27’s antitumor potential, specifically in NSCLC, such as the ability to drive myeloid cells towards antitumor activities, and down-regulate stemness genes, particularly in SCC cells, thus suppressing their self-renewal potential. IL-27 may thus be proposed for clinical trials with the prospect of its clinical use in immune-defective or advanced NSCLC patients.

Background:
The mitogen-activated protein kinase (MAPK) and phosphatidylinositol 3-kinase (PI3K) pathways are frequently altered in human cancers. Targeting these pathways is an attractive therapeutic strategy in malignant disease. The frequency of single and dual pathway alterations varies substantially across various cancers. Co-occurrence of the MAPK and PI3K pathway aberrations is reported in 5-7% of melanomas, gastric and colorectal cancers, and is associated with a worse clinical outcome. In this report we aim to determine the co-occurrence of the MAPK and PI3K pathway mutations in a large cohort of surgically resected NSCLC tumors.

Methods:
We used the platform of Sequenom’s MassArray to perform genotyping for 548 somatic hotspot mutations in 49 genes including genes in the MAPK and PI3K pathways in surgically resected NSCLC tumors. MAPK pathway genes that were screened include: KRAS, HRAS, BRAF, RAF1, MAP3K1, MAP3K2, MAP3K3, MAP3K4, MAP3K5, MAP2K1, MAP2K2, MAP2K3, and PTPN11. PI3K pathway genes that were screened include: PIK3CA, PIK3R1, PIK3R2, PTEN, PDPK1, AKT1, AKT2, and MTOR. Fisher’s exact test was used to determine the statistical significance of association between the MAPK and PI3K pathway mutations. The strength of association was determined in the form of odds ratio.

Results:
NSCLC tumors from 356 patients (258 squamous cell, 98 adenocarcinomas) were tested using Sequenom’s MassArray. The frequency of mutations in the MAPK and PI3K pathways was 22.5% (n=80) and 22.8% (n=81) respectively. Among these patients, 38 patients had mutations in both pathways (i.e: 47.5% of patients with a MAPK pathway mutation also had a mutation in the PI3K pathway, and 46.9% of patients with a PI3K pathway mutation also had a mutation in the MAPK pathway, see table 1). Fisher’s exact test revealed that mutations in the MAPK and the PI3K pathways are mutually inclusive (p<0.0001, odds ratio=4.95, 95% CI 2.9-8.5) Table 1: The co-occurrence of MAPK and PI3K pathway mutations in NSCLC

Pathway/no of patients	PI3K WT	PI3K MT
MAPK WT	235	43
MAPK MT	42	38

Conclusion:
38 (10.7%) of 356 NSCLC patients included in the LCGI study had hotspot somatic mutations in both the MAPK and PI3K pathways. Contrary to previous reports, we observed that activating mutations of the MAPK and PI3K pathways are mutually inclusive in NSCLC. These findings may have implications in designing clinical trials of targeted therapies in lung cancer.

Background:
Non-small cell lung cancer (NSCLC) is characterized by poor prognosis, and few molecular markers were proven to be associated with cancer metastasis. The aim of the study is to identify the associations between single-nucleotide polymorphisms (SNPs) and distant metastasis of adenocarcinoma of the lung in Korean population.

Methods:
We conducted a genome-wide association study (GWAS) of in 499 Korean lung adenocarcinomas comparing 4,653,588 SNPs genotypes. Analyses were performed to investigate the association between the germline variations in all genes and cancer metastasis, survival and cancer recurrence.

Results:
We undertook a gene-metastasis interaction analysis in a GWAS of lung cancer using a case-control study. (18cases and 481controls) The combined analyses identified two susceptibility loci for metastasis risk in lung adenocarcinoma: SYNE1 [rs117050208, p-value = 1.91 x 10[-14], odds ratio (OR) = 87] and QSOX1 (rs148150589, p-value = 4.46 x 10[-9], OR = 56.5). SYNE1 was known to play crucial roles in the dynamics of genetic progression in colorectal adenocarcinoma and QSOXI was considered a prognostic indicator of metastatic potential in the breast cancer. (Figure1) However, no significant association was found between SNPs and either survival or recurrence. Figure 1



Conclusion:
Our data suggest that the SYNE1 rs117050208 and the QSOX1 rs148150589 may serve as potential biomarkers to influence cancer metastasis in the Korean lung adenocarcinoma. The analysis of the rs117050208 and rs148150589 polymorphism can help identify patients at high risk of distant metastasis of lung adenocarcinoma.

Background:
Pathologic differentiation of neoplastic lesions in the lung with squamous cell histology is challenging as appropriate diagnostic immunohistochemical biomarkers are lacking. In particular patients with head and neck cancer and a smoking history can develop both lung metastases and primary lung cancer. Differentiation of primary lung cancer and lung metastases of head and neck cancer is clinically important for therapy and risk stratification. Furthermore, molecular targeted therapies for squamous cell carcinoma of the lung are largely lacking to date. Recent genetic studies uncovered multiple genetic subgroups of squamous cell carcinoma of the lung and moreover potential drug targets. However, the correlation between protein-expression/signaling activation patterns and genetic alterations is strongly influenced by co- and post-transcriptional as well as post-translational regulation. We characterized a broad panel of primary patient-derived formalin-fixed squamous cell carcinomas from lung and head and neck cancer by quantitative mass spectrometry to identify proteomic diagnostic biomarkers, signaling patterns and potential novel drug targets.

Methods:
Proteins were extracted from formalin-fixed paraffin-embedded (FFPE) microdissected patient-derived cancer tissues by using the “filter-aided sample preparation (FASP)” method. Purified proteins were subsequently mixed with a cancer-matched isotope labeled quantification standard (Super-SILAC standard) that allows for identification and quantification of thousands of proteins and their phosphorylation sites by high-end mass spectrometry. Using bioinformatics we determined the protein expression and signaling patterns. The biomarkers discovered were validated by immunohistochemistry in additional independent tumor tissues.

Results:
In this study we quantitatively characterized the proteomes of 60 primary patient-derived non-small cell lung cancer specimens with squamous cell histology and 25 squamous cell carcinomas from the head and neck region derived from patients that developed lung tumors with similar histology in the course of their disease. Using the Super-SILAC-based mass spectrometric approach we were able to identify and quantify around 2500 proteins per sample. Unsupervised clustering- and principal component analyses revealed that the detected protein expression patterns show a strong correlation with the cellular origin of the analyzed carcinomas. Furthermore, secondary lesions with similar histological morphology in the lung in patients with squamous cell carcinoma of the head and neck region could be classified as primary or metastatic cancer according to their protein expression profiles.

Conclusion:
Collectively, this study provides a large set of proteomic biomarkers that can be used to improve lung cancer diagnostics in the future. In particular the differential diagnosis of squamous cell carcinoma/metastases in the lung, that has so far been difficult due to the lack of biomarkers, will be improved by the biomarker panels presented here. Moreover, the expression and activation patterns of kinases discovered in our study is of interest regarding potential novel lung cancer therapies as overexpression or hyperactivation of certain kinases can potentially contribute to the malignant phenotype of lung cancer cells.

Background:
To indentify the correlation of chest computed tomography appearance and the presence of oncogenic driver mutations in resected stage I lung adenocarcinoma

Methods:
Patients with resected stage I lung adenocarcinoma were analyzed from 2008-2012 and categorized into 3 groups: pure ground glass (GGO), mix-solid and ground glass, and solid patterns. All patients underwent driver mutation analysis (26 genes and 89 point mutations) using a multiplex PCR-based assay from paraffin embedded tumors. Disease free survival (DFS) and overall survival (OS) were compared between patients with EGFR, KRAS and the wild-type tumors using Kaplan-Meier methods and Cox regression models.

Results:
237 patients who underwent curative resection for stage I lung adenocarcinoma were analyzed with a median follow-up 34 months. Female gender was observed in 68% (160/237) and 21% (50/237) were nonsmokers. Pure GGO was indentified in 9% (n=21), mixed solid in 69% (n=164), and solid in 22% (n=52) of cases. EGFR and KRAS mutation rates were 18.6% (n= 44) and 34.6% (n= 82), respectively. Univariate analysis showed that KRAS-mutated tumors (HR 1.91, 95% CI 1.37-2.67; p<0.01), solid component > 50%, (HR 2.65, 95% CI 1.03-6.8; p=0.04), and smoking status (HR 3.59, 95% CI 1.1-11.8; p=0.03) were associated with worse DFS. In multivariate analysis only KRAS-mutated tumor (HR 1.84, 95% CI 1.31-2.59; p<0.01) was significant for worse DFS. KRAS-mutated tumor was also associated with worse OS in both univariate (HR 1.72, 95% CI 1.14-2.59; p=0.009) and multivariate (HR 1.65, 95% CI 1.09-2.49; p=0.018) analysis. Tumors that harbored >50% solid component on CT chest with a KRAS mutation were associated with worse DFS (HR 2.87, 95% CI 1.4-5.92; p=0.004) and OS (HR 2.51, 95% CI 1.03-6.1; p=0.04) in multivariate analysis compared to wild type tumors that were < 50% solid.

Conclusion:
KRAS mutation status and percent solid component on chest CT were predictive of worse outcome in surgically resected stage I lung adenocarcinoma

Abstract not provided

Background:
The introduction of targeted therapy has transformed the care of patients with lung cancer by incorporating tumour genotyping into therapeutic decision making. Recent improvements in sequencing technology have allowed for a rapid and broad snapshot of a tumour’s genetic landscape. Circulating cell-free tumour DNA (cfDNA) can be detected in patients with solid organ malignancies and has the potential to be used as a non-invasive biomarker (“liquid biopsy”). By integrating the two approaches, it is possible to detect specific mutational events in diagnostic samples, assess tumour burden, longitudinally monitor the response to therapeutic intervention and detect disease recurrence. As we have shown previously, it may also facilitate the detection of emergent subclonal populations, including variants that confer resistance to specific therapeutic agents.

Methods:
30 unselected treatment-naive patients with lung cancer were recruited from clinic. Paired DNA from tumour biopsies and plasma was obtained. Targeted next-generation sequencing (NGS) was performed on the tumour biopsy DNA. Primer sets and probes for identified mutations were optimised and validated on a microdroplet digital PCR (mdPCR) system.

Results:
25 of 30 patients in our test cohort had stage IIIB/IV non-small cell lung cancer. 25 of 30 patients (83%) of patients had mutations identified in their diagnostic specimen. 4 out of the 5 patients with no identifiable mutation in their diagnostic specimen presented with early disease and underwent curative surgery. The diagnostic specimens included endobronchial ultrasound (EBUS) samples, percutaneous and pleural biopsies, surgical resection specimens and a brain biopsy. The corresponding mutation was then assayed in cfDNA and was detected in the pre-treatment plasma samples in 90% of patients. Results to date from this cohort will be presented in detail. There has been complete concordance between mutations identified as part of the clinical standard-of-care and our targeted NGS data.

Conclusion:
It is feasible to perform a targeted NGS analysis on DNA from standard diagnostic lung cancer specimens and design generic and patient-specific biomarkers for use in a mdPCR assay of cfDNA. We aim to validate this approach and embed it in future clinical trial protocols.

Background:
We have proposed that synergistic epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI)-chemotherapeutic interaction in lung cancer cells has 3 essentials: no platinum, cells not or no more sensitive to EGFR-TKI, and using a synergistic chemo partner, e.g., pemetrexed (P) (Tsai, et al. Lung Cancer 82:305, 2013).

Methods:
GENIUS study (NCT01579630) was a phase II, multicenter, randomized, open-label prospective trial comparing maintenance G/P versus P in patients with metastatic lung adenocarcinoma (mLADC) harboring no sensitizing EGFR mutations (sEGFRm) detected by high sensitivity methods following a 4-cycle P/Platinum induction therapy in frontline setting. Patients with no disease progression (PD) were 1:1 randomized to receive P (500 mg/m[2], 3-week cycle) ± G (250 mg, daily) until PD or treatment failure, and stratified by study site and response. The primary endpoint was progression free survival (PFS) by both independent radiologist review (IRR) and investigator assessment (IA), secondary endpoints included time to treatment failure (TTF), overall survival (OS), safety and toxicity profile.

Results:
Between 03/2011 and 11/2013, 55 patients were randomized, G/P 26, P 29. Baseline characteristics were balanced between arms (age 57; female 42%; never smoker 55%; ECOG1 91%; ≥2 metastatic sites 38.2%; ALK+ 16%). Median follow-up was 20.4 mo. Median cycle of treatment was G/P 9.5 (range 1-32) and P 4 (2-21). Median PFS was substantially longer for G/P than P, both by IRR (3 deemed as PD at randomization were excluded; n = 25 v 27): 8.4 v 3.8 mo; HR [95% CI] 0.42 [0.23-0.79]; p = 0.0057, and by IA: 8.7 v 2.9 mo; HR 0.38 [0.21-0.70], p = 0.0013. Response with induction therapy, age, and smoker had interactions with treatment for PFS. Median TTF: 7.0 v 2.9 mo; HR 0.46 [0.25-0.83], p = 0.0085. OS was also better for G/P than P by IRR (undefined v 29.3 mo; HR 0.44 [0.20-0.97]; p = 0.037) and IA (undefined v 21.7 mo; HR 0.46 [0.22-0.97]; p = 0.038). There were more treatment-related diarrhea, liver and skin toxicities on G/P v P, but generally mild. Two G/P patients were off-study due to liver toxicity.

Conclusion:
This proof of concept ph 2 study first demonstrated survival benefit of EGFR-TKI plus chemo in the maintenance phase of frontline treatment for patients with mLADC harboring no sEGFRm. This strategy deserves phase III study to confirm.

Background:
Advanced NSCLC pts with Zubrod PS2 are often excluded from clinical trials and platinum-based therapy. In SWOG 0341, erlotinib in PS 2 pts yielded progression-free (PFS) and overall survival (OS) of 2.1 and 5 months respectively. In a trial of erlotinib versus carboplatin/paclitaxel in PS2 pts (Lilenbaum, JCO 2008), PFS for erlotinib and chemotherapy were 1.9 and 3.5 months, respectively. Early reports suggested a potential role for serum proteomics in predicting erlotinib benefit beyond that of EGFR mutational status. We therefore conducted a prospective trial of erlotinib +/- chemotherapy in NSCLC pts with PS2 enriched by serum proteomics (Veristrat assay).

Methods:
Metastatic NSCLC pts with PS2, acceptable end-organ function, and “good” classification by serum proteomics were randomized to either Arm A (erlotinib 150 mg orally QD) or Arm B (erlotinib 150 mg orally QD on days 2-16 plus carboplatin AUC 5 IV day 1 and paclitaxel 200 mg/m2 IV day 1 x 4 cycles, followed by erlotinib 150 mg orally QD). Cycle length was 3 weeks. Arm B agents were “pharmacodynamically separated” to mitigate potential antagonism. The arm with superior observed median PFS would be selected for further evaluation, but only if ≥ 3 months. A sample size of 98 pts was based on a variety of assumed PFS probabilities for each arm. The trial was prematurely closed after the FDA determined midway through accrual that an IDE application was required for the proteomics assay; however SWOG had limited resources available for such filing.

Results:
Of 156 pts screened, 83 (59%) were classified as “good” by serum proteomics. 59 of 83 pts (60%) met trial eligibility and were randomized. Treatment-related grade 4 adverse events were seen in 2 pts in Arm A (thrombosis, hypomagnesemia) and 5 pts in Arm B (neutropenia -5, febrile neutropenia-1, leukopenia -1), with no treatment related deaths. Figure 1



Conclusion:
In Zubrod PS2 pts with advanced NSCLC and “good” classification by serum preoteomics, pharmacodynamically-separated erlotinib plus chemotherapy had better observed median PFS/OS versus erlotinib alone and surpassed the protocol-specified benchmark of PFS >= 3 months required for further study. Updated data will be presented.

Background:
National Comprehensive Cancer Network Guidelines recommend using VeriStrat, a blood proteomics test to determine using erlotinib instead of chemotherapy as second-line treatment for patients with non-small cell lung cancer (NSCLC). However, VeriStrat has not been evaluated in a first-line setting within a randomized trial.

Methods:
TOPICAL was a double-blind randomised placebo-controlled trial, for 670 chemotherapy-naive NSCLC patients (stage IIIb/IV) considered unsuitable for chemotherapy, mainly due to poor performance status (ECOG ≥2) or co-morbidities. They were randomized to receive best supportive care plus oral placebo or erlotinib (150mg/day) until disease progression/toxicity. Although there was no overall survival (OS) benefit among all patients, patients on erlotinib who developed first-cycle rash had improved OS, compared to placebo: hazard ratio (HR 0.76), p=0.006; unlike those without rash (HR 1.30, p=0.017). Pre-treatment serum samples were available for 477 of 670 (70%) TOPICAL patients. They were sent as anonymised aliquots to Biodesix for VeriStrat testing.

Results:
VeriStrat testing classified 52% (250/477) as having good outcomes, 46% (221) poor outcomes, and 6 unknown. In all patients, VeriStrat classification was associated with OS (good vs. poor: HR=0.58, 95%CI 0.47-0.73; P<0.0001) and PFS (HR=0.72; 95% CI 0.53-0.97; P=0.002), after allowing for gender, histology, stage, treatment and first-cycle rash (unadjusted HRs were similar, as were those ignoring rash). In all erlotinib patients, median OS was 4.9 (good) vs. 3.1 months (poor); HR=0.63, 95% CI 0.47-0.85, p=0.002. The corresponding results among all placebo patients were: 5.3 (good) vs. 2.9 months (poor), HR=0.53, 95% CI 0.39-0.73, p<0.001. Similar results were found for PFS: median 3.1 (good) vs. 2.2 (poor) months (HR=0.72; 95% CI 0.53-0.96, P=0.027) for erlotinib patients; and 2.8 vs. 2.4 months for placebo patients (HR=0.72, 95% CI 0.53-0.97, p=0.033). Among all patients, VeriStrat was not predictive: OS HR for erlotinib vs. placebo was 1.02 (95% CI 0.79-1.31) in the ‘good’ group, and 0.86 (95% CI 0.66-1.12) for ‘poor’; interaction p-value=0.38. Corresponding PFS HRs were 0.86 (95% CI 0.67-1.10) and 0.84 (95% CI 0.65-1.10); interaction p-value=0.92. VeriStrat was also not predictive when allowing for first-cycle rash (Table 1). However, among patients who had rash, those with ‘good’ classification had longer OS (p<0.001) and PFS (p=0.001) than those classified as ‘poor’. Figure 1



Conclusion:
Our large randomized trial among NSCLC patients considered unsuitable for chemotherapy shows that VeriStrat status was prognostic for OS and PFS; but it was not predictive for OS nor PFS, in relation to erlotinib vs. placebo as first-line treatment.

Background:
Erlotinib in 2[nd] line improves survival in patients with recurrent/progressive NSCLC, is also active in squamous cell NSCLC, as reported in a BR.21 study subgroup. So far, no prospective non interventional study has specifically evaluated patients with this histological subtype treated with erlotinib. We present the final results of PEPITA cohort.

Methods:
PEPITA is a French multicenter, prospective cohort study assessing erlotinib modalities of use in daily practice in squamous NSCLC. The primary endpoint was progression-free survival (PFS); secondary endpoints included patients’ characteristics, overall survival (OS), safety and quality of life. EGFR mutation was tested in 41 patients (28.5%) reason why exploratory analyses assessing EGFR genotyping and smoking status were also performed.

Results:
Between June 2012 - May 2013, 152 patients were included and 146 patients were analyzed for efficacy; median follow-up was 5.31 months (0.03-17.65).

Patients characteristics at baseline	Efficacy population (n=146)	EGFR tested (n=41)	EGFR not tested* (n=103)	p-value
Mean age (±SD), years Men	67.7 (±8.6) 90.4%	67.4 (±8.9) 87.8%	67.8 (±8.6) 92.2%	0.79 0.52
ECOG PS 0/1 ECOG PS 2/3	17.5% / 43.8% 33.6% / 5.1%	n=39 20.5% / 56.4% 23.1% / 0	n=96 16.7% / 38.5% 38.5% / 6.3%	0.09
Current smoker Former smoker Never smoker	28.8% 63.7% 7.5%	24.4% 63.4% 12.2%	31.1% 63.1% 5.8%	0.39
Comorbitities : Cardiovascular Endocrinological Pulmonary	63.0% 23.3% 19.9%	65.9% 22.0% 19.5%	62.1% 23.3% 20.4%	0.68 0.86 0.91

* 2 patients without EGFR mutation status Efficacy and genotyping results were:

	EGFR mutation not tested n=103	EGFR mutation tested n=41	Non-smoker n=11	Smoker/Ex-smoker n=135	Efficacy population n=146
PFS
Event (progression or death)	95 (92.2%)	34 (82.9%)	8 (72.7%)	123 (91.1%)	131 (89.7%)
Median (months)	2.8 [2.3;3.2]*	4.4 [2.9;5.8]*	3.3 [0.7;ND]*	3.0 [2.7;3.5]*	3.0 [2.7;3.5]*
Survival rates at 12 months	7.0% [3.1;13.1]*	10.7% [3.1;23.6]*	27.3% [6.5;53.9]*	6.3% [2.9;11.6]*	8.0% [4.2;13.4]*
OS
Event (progression or death)	79 (76.7%)	22 (53.7%)	6 (54.5%)	96 (71.1%)	102 (69.9%)
Median (months)	5.5 [4.0;6.4]*	9.1 [4.4;ND]*	8.0 [1.6;ND]*	5.8 [4.5;7.1]*	5.8 [4.7;7.1]*
Survival rates at 12 months	22.4% [14.5;31.3]*	37.1% [20.9;53.5]*	43.6% [14.7;69.9]*	24.8% [17.2;33.0]*	26.3% [18.9;34.3]*

*[95% CI] In the safety population (n=152 patients), 158 adverse events (AEs) were reported in 70 patients (46.1%), including 48 grade ≥ 3 AEs in 31 patients (20.4%). The most frequent AEs related to erlotinib were skin rash (all grades [23,7%], grade ≥ 3 [5,2%]) and diarrhea (all grades [11,8%], grade ≥ 3 [2.0%]); 19 serious adverse events (SAEs) were reported in 12 patients (7.9%), including 16 grade ≥ 3 SAEs in 10 patients (6.6%). There were 6 SAEs leading to death (3.9% patients), but none SAE was related to erlotinib.

Conclusion:
PEPITA is the first non-interventional study assessing modalities of use in daily practice of patients with stade IIIb/IV squamous NSCLC treated in 2[nd] line with erlotinib. This final analysis show similar efficacy and safety results to those observed in clinical trials. Clinical profile may drive EGFR genotyping.

Abstract not provided

Background:
The REVEL trial demonstrated that second-line treatment with ramucirumab (RAM) plus docetaxel (DOC) significantly improved overall survival (OS) compared to placebo (PBO) plus DOC in the intent-to-treat (ITT) population (N=1253) of patients with stage IV non-small cell lung cancer. The REVEL trial also significantly improved progression-free survival (PFS) and objective response rates (ORRs). Results from the East Asia (EA) subgroup (Taiwan and Korea) analysis are presented.

Methods:
Subgroup analyses were performed in the EA ITT population, which consisted of all patients who were randomized in Taiwan (n=27) and Korea (n=62). Endpoints evaluated in the EA subgroup were OS, PFS, ORR, and safety. OS and PFS were analyzed using the Kaplan-Meier method and Cox proportional hazard model. Response was compared using the Cochran-Mantel-Haenszel test. ClinicalTrials.gov number NCT01168973.

Results:
In the 89 ITT EA patients, median OS was 15.44 months for the RAM plus DOC arm (n=43) and 10.17 months for PBO plus DOC arm (n=46) (HR: 0.762, 95% CI: 0.444–1.307). Median PFS was 4.88 months for the RAM plus DOC arm and 2.79 months for the PBO plus DOC arm (HR: 0.658, 95% CI: 0.408–1.060). The ORRs were 25.6% (95% CI: 13.5–41.2) in the RAM plus DOC arm and 9% (95% CI: 2.4–20.8) in the PBO plus DOC arm. Approximately two years after the enrollment of the first patient, in May 2012, the independent data monitoring committee recommended a reduction in the dose of DOC from 75 mg/m[2] to 60 mg/m[2] for newly enrolled EA patients, based on a higher incidence of neutropenia and febrile neutropenia associated with 75 mg/m[2] in EA patients compared to non-EA patients. This amendment resulted in a reduction in the toxicity associated with the original treatment regimen (Table). Table: Select grade ≥3 treatment-emergent adverse events, regardless of causality, by treatment arm and DOC dose in EA patients

Preferred term	RAM plus DOC (75 mg/m[2]) (n = 32)	PBO plus DOC (75 mg/m[2]) (n = 33)	RAM plus DOC (60 mg/m[2]) (n = 11)	PBO plus DOC (60 mg/m[2]) (n = 13)
Any	31 (96.9)	26 (78.8)	6 (54.5)	7 (53.8)
Neutropenia*	26 (81.3)	24 (72.7)	6 (54.5)	5 (38.5)
Febrile neutropenia	14 (43.8)	4 (12.1)	0	1 (7.7)

Data are n (%). *Consolidated term.

Conclusion:
Although not statistically powered to demonstrate significant improvement, the improved OS, PFS, and ORR observed in the EA subgroup treated with RAM plus DOC is consistent with the treatment effect observed in the overall ITT population in the REVEL trial. A dose reduction in DOC from 75 mg/m[2] to 60 mg/m[2] was associated with an improved safety profile and a reduction in the incidence of febrile neutropenia in the EA subgroup.

Background:
Nintedanib is a triple angiokinase inhibitor of receptors for vascular endothelial growth factor (VEGF), platelet-derived growth factor and fibroblast growth factor. The randomized, placebo-controlled, Phase III LUME-Lung 1 study (NCT00805194; 1199.13) investigating nintedanib/docetaxel was the first trial of an antiangiogenic agent to demonstrate significant overall survival (OS) benefit in previously treated patients with non-small cell lung cancer (NSCLC) of adenocarcinoma histology; nintedanib/docetaxel is approved in the European Union for the treatment of patients with locally advanced, metastatic or locally recurrent NSCLC of adenocarcinoma histology after 1[st]-line chemotherapy. Here we report LUME-Lung 1 data from the adenocarcinoma population who received 1[st]-line chemotherapy containing bevacizumab, pemetrexed or taxanes.

Methods:
In LUME-Lung 1, 1314 patients with Stage IIIB/IV recurrent NSCLC received either nintedanib/docetaxel or placebo/docetaxel. Primary endpoint was centrally assessed progression-free survival (PFS); OS was a key secondary endpoint. Prior treatment with anti-VEGF agent bevacizumab was a stratification factor. Analyses of the adenocarcinoma population (n=658) according to prior treatment with bevacizumab (n=45 in either arm), pemetrexed (1[st]-line [n=126] or maintenance [n=27]) or taxanes (n=142) were performed to determine if 1[st]-line regimens could influence subsequent outcomes for nintedanib/docetaxel.

Results:
Patient characteristics were generally well-balanced across prior-treatment subgroups. For the adenocarcinoma population, there was no interaction between 1[st]-line treatment with bevacizumab, pemetrexed or taxanes and treatment outcome with nintedanib/docetaxel. Independent of pretreatment, nintedanib/docetaxel-treated adenocarcinoma patients had an OS benefit (Table). In the overall patient population, efficacy outcomes for these subgroups were also similar regardless of prior treatment. Furthermore, there was no significant effect on nintedanib/docetaxel outcomes for the few adenocarcinoma patients who received maintenance pemetrexed. The adverse event (AE) profile for nintedanib/docetaxel in each subgroup was consistent with that reported for the adenocarcinoma population in LUME-Lung 1, with diarrhea and reversible liver enzyme elevations among the more frequently reported AEs. Among patients who received nintedanib/docetaxel, there was no difference between prior-treatment subgroups in the frequency of AEs commonly associated with the prior treatment, such as hypertension with bevacizumab, mucositis with pemetrexed and peripheral neuropathy with taxanes.

Conclusion:
In LUME-Lung 1, regardless of whether a patient with NSCLC of adenocarcinoma histology received 1[st]-line chemotherapy containing bevacizumab, pemetrexed or taxanes, subsequent treatment with nintedanib/docetaxel led to improved OS.

Table: OS results in patients with NSCLC of adenocarcinoma tumor histology stratified by ± prior 1st-line bevacizumab, pemetrexed or taxanes treatment

	No BEV		BEV		No PEM		PEM		No TAX		TAX
	N/D	Pl/D	N/D	Pl/D	N/D	Pl/D	N/D	Pl/D	N/D	Pl/D	N/D	Pl/D
Patients, n	298	315	24	21	261	271	61	65	245	271	77	65
Median OS, months	12.6	10.6	14.9	8.7	13.4	10.8	12.0	8.0	12.2	10.3	15.1	11.6
HR (95% CI)	0.85 (0.71–1.01)		0.61 (0.31–1.20)		0.83 (0.68–1.00)		0.79 (0.53–1.18)		0.86 (0.71–1.05)		0.75 (0.51–1.11)
Interaction p-value	p=0.24				p=0.90				p=0.61

BEV, bevacizumab; CI, confidence interval; HR, hazard ratio; N/D, nintedanib/docetaxel; NSCLC, non-small cell lung cancer; OS, overall survival; PEM, pemetrexed; Pl/D, placebo/docetaxel; TAX, taxanes.

Background:
Nintedanib (N; Vargatef[®]), a triple angiokinase inhibitor, is approved in the EU in combination with docetaxel (D) for the treatment of patients with advanced NSCLC of adenocarcinoma histology (ACH) after 1[st]-line chemotherapy. In the randomized, placebo-controlled, Phase III LUME-Lung 1 study (NCT00805194; 1199.13), N+D significantly improved overall survival (OS; secondary endpoint) vs D in patients with ACH (median OS: 12.6 vs 10.3 months (m); HR: 0.83 [95% CI: 0.70–0.99]; p=0.0359) and in patients who progressed either during or within 9 m of 1[st]-line therapy (time[T]<9m) (median OS: 10.9 vs 7.9 m; HR: 0.75 [95% CI: 0.60–0.92]; p=0.0073). We explored the impact of on tumor growth over time as a treatment effect of N+D, with a specific focus on early progressors (T<9m) and patients who had progressive disease as best response to 1[st]-line therapy (PD-FLT).

Methods:
Tumor growth was evaluated using all available tumor measurements. Mixed-effects models were used to quantify the non-linear individual relationships between time from randomization and tumor burden, measured as the sum of longest diameter of target lesions (SLD) and assessed by independent central review (RECIST 1.0). Analyses were conducted for the entire population of patients with ACH, T<9m and PD-FLT.

Results:
Estimated mean baseline SLD was 82.5 mm in all patients with ACH, 88.3 mm in T<9m and 98.1 mm in PD-FLT. N+D showed a significant reduction of tumor growth over time (p<0.0001) in patients with ACH compared to D. Treatment difference at 6 months (SLD D group – SLD N+D group) for patients with ACH was 9.7 mm. This treatment difference was even more pronounced in the T<9m group (16.8 mm) and in patients with PD-FLT (19.7 mm). Tumor growth over time for N+D showed a non-linear J-shaped curve, indicating a decline in SLD at the beginning of treatment, which was maintained over time followed by a linear increase (see Figure for curves for the T<9m group). This relationship was consistently observed between populations. For patients treated with D, a linear increase in SLD from baseline over time in all ACH patients, T<9m and PD-FLT was observed. Figure 1



Conclusion:
In the LUME-Lung 1 study, N+D significantly decreased tumor burden and decelerated tumor growth over time compared to D in all patients with ACH and in the groups of patients with the poorest prognosis.

Abstract not provided

Background:
Metastatic non-small cell lung cáncer (NSCLC) is associated with a poor prognosis, and palliative chemotherapy is the mainstay of treatment. However, long-time survival has been observed in oligometastatic patients treated with locally ablative therapies to all sites of tumoral disease. Oligometastatic NSCLC with unresectable primary tumor at diagnosis represents a therapeutic challenge, and nowadays there is limited evidence about the benefit of the treatment with radical intention of both primary tumor and metastases.

Methods:
Retrospective study of patients with oligometastatic (3 or less lesions, in a unique location) and unresectable NSCLC treated with radical chemo-radiotherapy at primary tumor and with surgery or stereotactic radiation therapy to the metastases. We have done a systematic review of clinical histories from NSCLC advanced patients diagnosed between October 2011 and March 2015. The aim of our study is to analyze the safety and efficacy of this treatment strategy in terms of response rate, progression free survival (PFS) and overall survival (OS).

Results:
Twenty-three patients met inclusion criteria. Median age 57 year, eighteen male (78,3%) and ECOG (0-1) 95,7%. Histology: 15 adenocarcinoma (65,2%), 5 squamous carcinoma (5%), and 3 (13%) others. All patients had unresectable mediastinal lymph nodes infiltration. Location of metastases included the brain (n=12, 52.2%), lung metastases (n=6, 26,1%), bone metastases (n= 3, 13%), adrenal (n=1, 4,3%) and lymph node (n=1, 4,3%). Chemotherapy: 9 CDDP-Pemetrexed (39,1%), 9 CDDP-Vinorelbina (39,1%), 3 Carboplatin-paclitaxel, 1 CDDP-Gemcitabina (4.3%), 1 CDDP-Docetaxel (4.3%). Ten patients (43.5%) received sequential thoracic radiotherapy and 12 (52.2%) concomitant. Metastases treatment: 12 stererotactic radiation (52.2%), 7 external radiotherapy (30, 4%), 3 surgery (13%), 1 radiofrequency (4.3%). Toxicity: four patients (17,39%) developed G3 toxicity (2 hematological, 1 pneumonitis, 1 esophagitis). Median follow up was 15 months, median OS 18 m, median PFS 11 months. The 1-year OS were 73.9%, 2-year OS 21,7% and 3-year OS 8.7%.

Conclusion:
Radical treatment of oligometastatic and unresectable NSCLC patients is a safe therapeutic strategy. Despite the limited data and the small numbers of our study, it could be contemplated as an effective therapeutic alternative for selected patients.

Background:
Stage IV non-small cell lung cancer (NSCLC) patients are considered incurable and mainly treated with palliative intent. The overall survival (OS) and disease free survival (DFS) of this patient group is considered as poor. The purpose of this study was to investigate the OS and DFS of NSCLC patients, diagnosed with synchronous oligometastatic disease treated with curative intent of the intrathoracic disease as well as the metastases.

Methods:
Patients treated between 2008 and 2014 were included in this retrospective cohort analysis. Main inclusion criteria were: synchronous presentation of NSCLC and oligometastatic disease at diagnosis, and multidisciplinary consent on a radical treatment of both the intrathoracic disease and the metastases. Besides systemic treatment. The intrathoracic disease was radically irradiated (> 55 Gy biological effective dose) or resected. Treatment of the metastases consisted of: radical/stereotactic radiotherapy, surgical resection or radiofrequency ablation (RFA).

Results:
A total of 56 patients, 31 men and 25 women, were included. The mean age was 61 years (range 36-79) and all were in good condition (WHO 0-1). Most patients had a solitary metastasis (brain (22), bone (17), adrenal gland (6), lymphe node (3), liver (2), soft tissue (1), pulmonary (1), thyroid gland (1) and breast (1)). Two patients had 2 metastases (liver and bone / pleural and bone). The intrathoracic tumor stage,ignoring M-status, was IA in 3 patients, IB in 2 patients, IIA in 8 patients, IIB in 4 patients, IIIA in 24 patients and IIIB in 15 patients. Fifty patients were treated with radiotherapy and 4 patients had a surgical intervention for the primary tumor; 2 patients only received systemical treatment for the intrathoracic disease. Fifty patients received chemotherapy (89%), of which 5 (10%) concurrent with the radiotherapy of the intrathoracic disease and 45 (90%) sequential. The metastases were treated with ablative/stereotactic radiotherapy (45), surgical intervention (2), only systemical treatment (5), combination of surgical intervention and radiotherapy (3) and RFA (1). The mean follow-up was 21 months (range 4-69). Forty-one (73%) patients developed recurrent disease of whom 29 (52%) died. Only 8 (20%) recurrences occurred within the irradiated area. Most recurrences where brain (13) and pulmonary metastases (11). For the whole group, the median DFS was 14 months (range 2-69, 95% CI 11-17) and the median OS was 32 months (range 4-69, 95% CI 16-48). The 1- and 2-year OS was 86% and 58%, respectively. The 1- and 2-year DFS was 66% and 30%, respectively.

Conclusion:
Radical local treatment of a highly selected group of NSCLC patients in good condition presenting with synchronous oligometastatic stage IV disease (maximum 2 metastases) resulted in excellent local control, and also in favorable long-term DFS and OS.

Background:
Stage IV Non-Small Cell Lung Cancer (NSCLC) is considered as an incurable disease with median survival of 6 to 12 months. Palliative platinum based chemotherapy is the standard therapy. It has been suggested that patients with one synchronous isolated metastasis (SIM) suitable for local therapy have longer survival.

Methods:
Database of the Multidisciplinary Thoracic Oncology Group of our centre was retrospectively screened from 1993 to 2012. Consecutive NSCLC of any stage were included. Median overall survivals (OS) between stage III and stage IV (SIM and non SIM) were compared with log-rank test. For the multivariate analyses Cox models were performed.

Results:
4917 patients were registered, 85 were excluded because of missing data. Among the study population, 1335 (27.6%) patients were stage III NSCLC, 1483 (31%) non SIM stage IV and 109 (2%) SIM stage IV. SIM site were mainly brain (n=70, 64%) and adrenal gland (n=16, 15%). Clinical and histological data differed substantially between each stage (Table 1). Median OS was significantly longer in SIM stage IV compared to non-SIM stage IV (18 [IQR, 9-33] months vs 6 [IQR, 2-13] months respectively, p-value<10[-4]) and not significantly different between SIM stage IV and stage III (14 months [IQR, 6-31], p-value=0.05). In multivariate analysis (Table 2), we still observed that median survival of SIM stage IV and stage III were not significantly different (p-value= 0.47).Figure 1 Figure 2





Conclusion:
OS of SIM stage IV is remarkably improved compared to non SIM stage IV, and comparable to stage III. This data supports aggressive treatment in the subgroup of SIM stage IV.

Background:
We retrospectively investigated the survival outcomes of stage III non-small-cell lung cancer (NSCLC) patients presenting with isolated brain failures (IBF) after definitive concurrent chemoradiotherapy (C-CRT) and treated with whole brain radiotherapy (WBRT) ± stereotactic radiosurgery (SRS) or surgery.

Methods:
A total of 162 patients with stage III NSCLC who were treated with platinum based C-CRT between January 2007 and December 2012 and presented with proven IBF with/without locoregional failures were included in this retrospective analysis. All patients received WBRT of 20-30 Gy (3-4 Gy/fx) ± SRS of 16-22 Gy or surgery. The primary and secondary end points were overall survival (OS) and identification of factors associated with longer survival.

Results:
Median follow-up was 12.7 months from the IBF diagnosis.IBF occurred at median 7.8 months (range: 1.7-46.4) from the commencement of C-CRT.WBRT was the sole local intervention in 78 patients whereas 55 and 29 patients received additional SRS or surgery mostly prior to WBRT. Median and 3-year survival rates were 11.7 months and 20.4%, respectively. In univariate analysis, controlled primary (20.3 vs. 6.4 months; p<0.001) and absence of extracranial metastasis development during follow-up (23.3 vs. 10.6 months; p<0.001) were determined to be significantly associated with longer OS times, which also retained their independent significance in multivariate analysis. Addition of SRS or surgery was related with better brain control rates but not OS in overall population. However, in patients presenting with ≤3 brain lesions and controlled lung primary the addition of SRS or surgery to WBRT was associated with significantly superior OS times than WBRT alone (25.8 vs. 8.2 months; p<0.001).

Conclusion:
Present results demonstrated that controlled lung primary and absence of extracranial metastasis development during follow-up period were the factors positively associated with longer OS after WBRT ± SRS or surgery in stage III NSCLC patients presenting with IBF after platinum based C-CRT.Additionally, our results suggested superior survival with addition of SRS or surgery to WBRT in patients with 1-3 brain lesions and controlled lung primaries.

Background:
The effectiveness of pulmonary metastasectomy for non-small cell lung cancer(NSCLC) is controversial. The aim of this study is to report the overall survival after pulmonary metastasectomy for NSCLC and to determine prognostic factors for survival.

Methods:
Between June 2003 and July 2007, 39 patients underwent pulmonary metastasectomy in single center. Data from first time of pulmonary metastasectomy were included and data from more than second time of pulmonary metastasectomy were excluded.

Results:
There were 24 men and 15 women, and the median age at pulmonary metastasectomy was 64.0 years. The median recurrence free time from initial pulmonary resection to pulmonary metastasectomy was 18.5 months. The overall 5-year survival rate was 67.2%. In univariate analysis, ager under 70 years, recurrence free time over 24 months, adenocarcinoma and normal CEA level were prognostic factors for overall survival. Gender, initial TNM stage, operation type of pulmonary metastasectomy, number and size of pulmonary nodule and distance from nodule to margin were not associated with overall survival.

Conclusion:
In selected patients, pulmonary metastasectomy for NSCLC may confer a good survival. It appears reasonable that such patients should be considered as surgical candidates.

Abstract not provided

Abstract not provided

Abstract:
Small cell lung cancer (SCLC) is an aggressive neuroendocrine (NE) tumour associated with poor 5-year survival rates. Given the difficulties associated with obtaining human material, genetically engineered mouse models (GEMMs) for SCLC have emerged as powerful pre-clinical tools for translational research. Inactivation of the tumour suppressor genes TRP53 and RB1 is almost universally found in human SCLC. Based on this observation, the Berns Laboratory generated a mouse model of sporadic SCLC whereby p53 and Rb1 loss was restricted to lung epithelial cells by intra-tracheal instillation of an Adeno-Cre virus (Cre expression is under the control of a ubiquitous CMV promoter). These mice develop NE lung tumours with striking morphological and genomic similarities to SCLC observed in human patients[1]. This model allows us to address questions that would not be possible using patient samples or cancer cell lines alone. In my presentation, I will provide an overview on the GEMMs for SCLC currently available. I will also touch upon the emergence of new gene editing technologies, such as CRISPR-Cas9, and how these techniques can be used to further manipulate current models to address clinically relevant questions. Lung cancers exhibit a high level of intra-tumoral heterogeneity. The histopathology of individual tumour subtypes, suggests that these tumours have distinct cells-of-origin, but this has not been formally shown. I will present the work we carried out to address the cellular origins of lung cancer, with a focus on the research we performed using the GEMM of SCLC (p53[f/f];Rb1[f/f]). Briefly, we generated a series of recombinant adenoviruses that target Cre-recombinase expression selectively in Club (Ad5-CC10-Cre), alveolar type 2 (Ad5-SPC-Cre) and neuroendocrine (Ad5-CGRP-Cre) cells[2]. To address the cellular origins of SCLC, we infected p53[f/f];Rb1[f/f] mice with our cell type-restricted Adeno-Cre viruses, listed above. Results from these studies show that inactivation of p53 and Rb1 can efficiently transform neuroendocrine (CGRP-positive) and to a lesser extent, alveolar type 2 (SPC-positive) cells leading to SCLC. In contrast, CC10-expressing cells were largely resistant to transformation. The results clearly indicate that neuroendocrine cells serve as the predominant cell-of-origin of SCLC. Interestingly genome-sequencing studies have revealed genetic aberrations that overlap with squamous cell carcinomas in a subset of SCLCs. Does this reflect a common cellular origin? I will present some recent data we have generated to address this question. References 1. Meuwissen R, Linn SC, Linnoila RI, Zevenhoven J, Mooi WJ and Berns A. Induction of small cell lung cancer by somatic inactivation of both Trp53 and Rb1 in a conditional mouse model. Cancer Cell 2003 vol. 4(3) pp. 181-189. 2. Sutherland KD, Proost N, Brouns I, Adriaesen D, Song J-Y and Berns A. Cell of origin in small cell lung cancer: inactivation of Trp53 and Rb1 in distinct cell types of the adult mouse lung. Cancer Cell 2011 vol. 19(6) pp. 754-764.

Abstract:
Small cell lung cancer (SCLC) is a neuroendocrine subtype of lung cancer characterized by a fast growth rate, extensive dissemination, and rapid resistance to chemotherapy. Survival rates are dismal and have not significantly improved in the past few decades. The group of Roman Thomas and Martin Peifer sequenced the genomes of over 100 human SCLC, which demonstrates universal inactivation of p53 and RB and identified inactivating mutations in NOTCH family genes in ~25% of tumors. Accordingly, we found that activation of Notch signaling in a pre-clinical SCLC mouse model dramatically reduces the number of tumors and extends the survival of the mutant mice. In addition to suppressing proliferation, active Notch inhibits neuroendocrine gene expression in SCLC cells. Thus, Notch plays a key tumor suppressive role in SCLC and strategies to re-activate Notch in SCLC tumors may be beneficial to patients (George, Lim, et al., in press). At the histological level, SCLC tumor cells are often viewed as homogeneous. These studies and previous studies (e.g. Calbo et al., Cancer Cell, 2011 – Berns lab) have identified several levels of intra-tumor heterogeneity in SCLC, which may contribute significantly to SCLC aggressive nature and resistance to therapy. We will also discuss the existence and the role of several subpopulations of SCLC tumor cells involved in the long-term propagation of this cancer type, the rapid acquisition of chemoresistance, and metastasis. A better understanding of the molecular underpinnings of these cellular heterogeneity may help identify novel therapeutic targets in SCLC.

Abstract:
Because SCLC tumors are seldom resected, in vitro models to study this “recalcitrant disease” are of crucial importance. The major strengths and limitations of the three basic preclinical model systems are summarized in Table 1. Table 1: Strengths and Limitations of Preclinical model systems for the study of SCLC

Preclinical Model	Strengths	Limitations
Tumor Cell lines (TCLs)	Spheroidal growth, cytological appearances and neuroendocrine (NE) cell properties.	May represent oligoclonal selection. Lacks stroma and vasculature.
Patient-derived xenografts (PDXs)	Histology and gene expression profile of tumors closely resemble human counterpart.	Stroma and vasculature are of host mouse origin. Lacks intact immune system. Metastatic spread limited. Possible contamination with murine xenotropic virus.
Genetically Engineered Mouse Models (GEMMs)	Reproduces pathology of NE carcinomas and similar metastatic pattern. Only model for studying multistage pathogenesis	Long latent time. Precise histology mixture variable.

Tumor Cell Lines SCLC lines have been established since the early 1970s. A large series of cell lines was established by Drs. Gazdar, Desmond Carney and John Minna.[1]Most lines retained the cytological and NE cell features of SCLC tumors. We have confirmed that vast majority of the NCI series of lines have retained these features even after 4 decades in culture. Some of the lines, especially those established after prior therapy and which had amplification of a MYC family gene, had atypical morphology and lacked some of the NE cell program. These were termed variant SCLC cell lines.[2]They remain the major resource for most of the biology studies performed in SCLC.[3] Constitutional sources of DNA are available for some of the lines. A major shortcoming is lack of cell lines established from the putative precursor cell, the NE cells of the respiratory epithelium. While most TCLs grow as two dimensional adherent monolayers, SCLC cultures naturally grow as three dimensional floating aggregates or spheroids. Several recent reports have suggested that three dimensional in vitro growth more closely resembles the natural growth characteristics of patient tumors, and may be more representative of drug response.[4] While they are an estimated 150 SCLC TCLs established worldwide, recent reports have been scarce. Two recent developments offered innovative new approaches to the establishment of SCLC lines. The finding that the circulating tumor cell burden in SCLC cases were extremely high and could be used to establish PDXs[5]was promising and also suggested that the circulating cells could be used to establish new SCLC TCLs. Recently a method for the propagation of epithelial cells of non-malignant and malignant origin, termed “Conditionally Reprogrammed Cells” (CRC) was described. CRC cells have properties of epithelial stem cells.[6]This method was widely utilized to generate many new putative lung cancer TCLs, mainly of NSCLC origin. Our extensive characterization (led by Boning Gao and John Minna) of CRC cells from NSCLC specimens indicated robust growth of epithelial cells apparently free of fibroblast contamination. However, characterization of the cells indicated that they mostly had properties of stem cells derived from non-malignant cells, and were diploid and lacked mutations present in the corresponding tumors. These results suggest, at least for lung cancer specimens, that the CRC method preferentially grows the non malignant epithelial stem cell component present in all lung cancer resections. Patient Derived Xenografts (PDXs) PDX tumors are generated by direct transfer of human tumor fragments or cell isolates from patient tumors to immune-deficient mice (or other rodent species). At least during early serial passage, PDXs retain the genetic and morphological characteristics of the original human tumor, including histological features, gene expression profiles, copy number variations and chromosomal stability of PDX tumors.[7] Thus, PDXs have been proposed as an advanced preclinical tool for therapy testing in a number of tumor types including lung cancers.[8] Most PDXs are inoculated subcutaneously. Orthotopic models for SCLC may increase metastatic potential and relevance for chemotherapy evaluation.[9] Intracranial heterotransplantation of SCLC into the brain provides a model to study intracranial and leptomeningeal meatastases.[10] The mouse genome contains over 500,000 copies of integrated strains of mouse leukemia virus virus. Some strains are xenotropic and grow efficiently in human cells. Serial transplantation of PDXs, especially SCLC, is associated with a high frequency of xenotropic virus contamination,[11]which poses potential health risks and may influence genetic analyses. Genetically engineered mouse models (GEMMs) Berns developed the double knockout model (lacking p53 and Rb1 that closely recapitulated the histology and metastatic pattern of SCLC, but had a relatively long latent period.[12]Several triple knockout variants of the basic model have been developed, specifically to reduce the long latent period. However, these variations often have more complex histologies, reflecting the spectrum of high grade NE carcinoma of the lung. The resultant histological phenotypes were influenced by multiple factors. The lengthy latent time permitted observations of the preneoplastic and premalignant stages of SCLC development, which are seldom observed in human tumors because of the explosive growth of SCLC once it becomes invasive. The long latent period is caused by the development of secondary genetic changes required for tumor formation such as alterations of the PTEN and NFIB genes.[13]A recent review[12]concluded that GEMM models studied are representative for the entire spectrum of human high-grade NE carcinomas and are also useful for the study of multistage pathogenesis and the metastatic properties of these tumors. Summary The major In vitro models for SCLC each have their individual strengths and weaknesses. Each has to be carefully evaluated for its suitability for the proposed experimental approach. Despite their limitations, In vitro models remain the single most important source of knowledge about the non-clinical aspects of SCLC and will likely remain so into the foreseeable future. 1. Phelps RM, Johnson BE, Ihde DC, et al. NCI-Navy Medical Oncology Branch cell line data base. J Cell Biochem 1996;Suppl. 24:32-91. 2. Gazdar AF, Carney DN, Nau MM, et al. Characterization of variant subclasses of cell lines derived from small cell lung cancer having distinctive biochemical, morphological, and growth properties. Cancer Res 1985;45:2924-2930. 3. Gazdar AF, Girard L, Lockwood WW, et al. Lung cancer cell lines as tools for biomedical discovery and research. Journal of the National Cancer Institute 2010;102:1310-1321. 4. Breslin S, O'Driscoll L. Three-dimensional cell culture: the missing link in drug discovery. Drug Discov Today 2013;18:240-249. 5. Hodgkinson CL, Morrow CJ, Li Y, et al. Tumorigenicity and genetic profiling of circulating tumor cells in small-cell lung cancer. Nat Med 2014;20:897-903. 6. Liu X, Ory V, Chapman S, et al. ROCK inhibitor and feeder cells induce the conditional reprogramming of epithelial cells. The American journal of pathology 2012;180:599-607. 7. Rosfjord E, Lucas J, Li G, et al. Advances in patient-derived tumor xenografts: from target identification to predicting clinical response rates in oncology. Biochem Pharmacol 2014;91:135-143. 8. Moro M, Bertolini G, Tortoreto M, et al. Patient-derived xenografts of non small cell lung cancer: resurgence of an old model for investigation of modern concepts of tailored therapy and cancer stem cells. J Biomed Biotechnol 2012;2012:568567. 9. Isobe T, Onn A, Morgensztern D, et al. Evaluation of novel orthotopic nude mouse models for human small-cell lung cancer. J Thorac Oncol 2013;8:140-146. 10. Gazdar AF, Carney DN, Sims HL, et al. Heterotransplantation of small-cell carcinoma of the lung into nude mice: comparison of intracranial and subcutaneous routes. Int J Cancer 1981;28:777-783. 11. Zhang YA, Maitra A, Hsieh JT, et al. Frequent detection of infectious xenotropic murine leukemia virus (XMLV) in human cultures established from mouse xenografts. Cancer Biol Ther 2011;12:617-628. 12. Gazdar AF, Savage TK, Johnson JE, et al. The comparative pathology of genetically engineered mouse models for neuroendocrine carcinomas of the lung. J Thorac Oncol 2015;10:553-564. 13. McFadden DG, Papagiannakopoulos T, Taylor-Weiner A, et al. Genetic and clonal dissection of murine small cell lung carcinoma progression by genome sequencing. Cell 2014;156:1298-1311.

Abstract:
Circulating Tumour Cells Dr Fiona Blackhall and Professor Caroline Dive Progress in understanding the molecular biology of small cell lung cancer has undoubtedly been hampered by lack of tissue resources suitable for comprehensive systems biology analysis. Tissue quantities sufficient for molecular analysis are more commonly from surgical resections and open biopsies from patients with very limited stage disease and therefore not representative of the majority of SCLC patients. Serial biopsies are even rarer to obtain. As an alternative to tumour tissue, circulating tumour cells (CTCs) are highly prevalent and abundant in patients with SCLC. These surrogate biomarkers, increasingly referred to as ‘virtual’ or ‘liquid’ biopsies, may be more relevant to understanding the biology of this disease that is hallmarked by early and widespread haematogenous dissemination. In our own series (Hou et al. JCO 2012) blood samples from 97 treatment naive patients, 31 with limited stage (LS) and 66 with extensive stage (ES), were assessed for CTCs using the EpCam-based immunomagnetic detection method, CellSearch. CTCs were detectable in the majority (85%) of patients and abundant. The mean ± standard deviation for CTC number(#) in a 7.5ml blood sample was 1,589 ± 5,565 and median CTC# was 24 (range 0 – 44, 896). CTC# was significantly associated (higher) with ES, lactate dehydrogenase, presence of liver metastases and number of sites of metastases. In multivariate analysis, adjusting for these clinical associations, pretreatment CTC# and change in CTC# after one cycle of chemotherapy were independent prognostic factors. A statistically derived cut off of 50 CTCs demonstrated most significant discrimination in survival estimation. The overall survival was 5.4 months for patients with ≥ 50 CTCs/7.5 mL of blood compared with 11.5 months (P < .0001) for patients with less than 50 CTCs/7.5 mL of blood before chemotherapy (hazard ratio = 2.45; 95% CI, 1.39 to 4.30; P =0 .002). In addition to prognostic information CTCs are pharmacodynamic and amenable to biomarker assay development (protein expression, omic profiling, FISH etc). CTCs ex vivo are also tumourigenic. We have established a series of CTC derived xenografts (CDX) in immune compromised (IC) mice (Hodgkinson et al. Nat Med 2014). Of 6 initial patients whose CTCs were implanted in IC mice, 4 gave rise to tumours in less than 5 months. Implantation and CDX tumour formation was associated with higher CTC# (>400 CTCs / 7.5mls of blood). The immunohistochemical characteristics of the CDX tumours were consistent with SCLC morphology and neuroendocrine marker expression. Whole genome sequencing demonstrated that the tumours had mutations (e.g. TP53 and RB1) and copy number variation (e.g. loss of 3p and 13q) commonly observed in SCLC. Furthermore, the same genetic abnormalities as the CDX were present in single cells CTCs isolated from the corresponding patient. On exposure of the CDX to platinum and etoposide chemotherapy a remarkable correlation was observed for the tumour responses compared to the patients’ tumour responses and survival. For example the most chemoresistant CDX was established from CTCs of a patient who survived for only 0.9 months and who had chemorefractory disease, whereas the most chemosensitive CDX was obtained from a patient who responded to platinum/etoposide chemotherapy and who survived for 9.7 months. A CDX of intermediate chemosensitivity was derived from a patient who survived for 3.5 months. Once the CDX tumours are established they can be harvested for passage, frozen and resurrected. Ongoing work aims to establish serial CDX models from patients who have progressed after initial treatment for study of biology, particularly that of acquired chemoresistance, and for preclinical testing of novel therapeutics in treatment naïve and previously treated SCLC. There is also possibility to incorporate serial CTC analysis and CDX model generation into clinical trials as ‘co-clinical trials’ with interrogation of pharmacodynamic and putative predictive biomarkers in addition to discovering mechanisms of resistance to novel therapeutics. CTC analysis and CDX model generation are technically challenging and resource intensive, but essential tools to further develop if we are to end the impasse on a targeted therapy breakthrough for this disease. References Hou JM, Krebs MG, Lancashire L, Sloane R, Backen A, Swain RK, Priest LJ, Greystoke A, Zhou C, Morris K, Ward T, Blackhall FH, Dive C. Clinical significance and molecular characteristics of circulating tumor cells and circulating tumor microemboli in patients with small-cell lung cancer. J Clin Oncol. 2012 Feb 10;30(5):525-32. Hodgkinson CL, Morrow CJ, Li Y, Metcalf RL, Rothwell DG, Trapani F, Polanski R, Burt DJ, Simpson KL, Morris K, Pepper SD, Nonaka D, Greystoke A, Kelly P, Bola B, Krebs MG, Antonello J, Ayub M, Faulkner S, Priest L, Carter L, Tate C, Miller CJ, Blackhall F, Brady G, Dive C. Tumorigenicity and genetic profiling of circulating tumor cells in small-cell lung cancer. Nat Med. 2014 Aug;20(8):897-903.

Abstract:
A leading cause of death in small cell lung cancer (SCLC) is the rapid emergence of drug resistance following an initial phase of chemotherapy and radiation sensitivity. Currently, response rates to existing second-line regimens (e.g., topotecan and other single-agent chemotherapies) are less than 20%. Because of this overall poor response to subsequent therapy, average survival for relapsed disease ranges between 4-6 months. As such, there is a critical need for the development of novel, active therapies for SCLC. Drugs that target DNA damage response (DDR), including PARP inhibitors, have shown promising activity against SCLC in pre-clinical models and in early clinical trials. Previously, we performed proteomic profiling of a large panel of SCLC cell lines which led to the observation that PARP1, Chk1, and several other DNA repair proteins are expressed at high levels in SCLC[1]. PARP1 overexpression was confirmed in patient tumors at the protein level by immunohistochemistry and at the mRNA level. Based on this finding, several PARP inhibitors were tested in pre-clinical models of SCLC. Olaparib, rucaparib, and talazoparib (previously BMN-673) all demonstrated striking single agent activity in a majority of SCLC cell lines tested. Furthermore, the addition of a PARP inhibitor to standard chemotherapies (e.g., cisplatin, etoposide and/or topotecan) and radiation further potentiated their effect[1][,][2]. In animal models including xenografts and patient-derived xenografts (PDXs), talazoparib has demonstrated significant anti-tumor activity as a single agent, comparable or superior to cisplatin[3][,][4]. Following these observations, several clinical trials were initiated to investigate the effects of PARP inhibition in SCLC patients. The first two studies to complete enrollment investigated the use of PARP inhibitors in relapsed SCLC. In the first study, single-agent talazoparib (BMN-673) was tested in an expansion cohort of patients with platinum-sensitive SCLC relapse (NCT01286987). Preliminary data from this trial demonstrated 2/23 patients with RECIST confirmed partial responses and 3/23 with stable disease lasting more than 24 weeks (clinical benefit rate of 25%). More than half of patients treated had some tumor volume reduction as their best response[5]. In the second study, the oral alkylating drug temozolomide with or without veliparib (ABT-888) was studied in 100 patients with sensitive or refractory relapse (NCT01638546). This trial recently completed enrollment and analysis of the results are ongoing. The use of PARP inhibitors in combination with chemotherapy builds upon prior pre-clinical data in lung cancer and other malignancies supporting the notion that PARP inhibitors potentiate the effect of other DNA damaging therapies. Currently, there are two studies investigating the use of veliparib (ABT-888) in combination with standard frontline chemotherapy (NCT01642251 and NCT02289690). E2511 (NCT01642251) is a Phase I/II trial of cisplatin, etoposide, and veliparib conducted through the ECOG-ACRIN Cancer Research Group in which treatment naïve SCLC patients receive the combination for up to 4 cycles. Published results from the Phase I portion support the safety and tolerability of the combination, with partial or complete responses observed in 5/7 evaluable patients[6]. More recently, another first-line study was initiated to investigate carboplatin in combination with etoposide and veliparib which will also address the question of veliparib maintenance (NCT02289690). To date, the activity of PARP inhibitors are best established in cancers with mutations in BRCA1/2 and other DNA repair genes that result in synthetic lethality in the setting of PARP inhibition (which provides a second “hit” to the DNA repair machinery). In fact, olaparib monotherapy was FDA-approved last year for patients with advanced, BRCA-mutated ovarian cancer who have received three or more lines of chemotherapy. This was based on a trial that demonstrated a response rate of 34% and a median duration of response or 7.9 months. Studies of other PARP inhibitors have also shown striking single-agent activity with this class of drugs in a mutation-selected population. However, in SCLC, the mechanism of action and identification of potential biomarkers of response to these drugs is an area of active investigation. Likely the universal loss of RB1, with resulting dependence on E2F1, plays a role, as may the PARP-trapping effects of several of these drugs which cause direct cytotoxicity[7]. Our group has demonstrated that expression levels of several DNA repair proteins – both individually and as a “DNA repair signature” – are associated with response in pre-clinical models of lung cancer[3]. However, further validation in the clinical setting is warranted. Additional DNA damage response (DDR) targets also show significant potential as therapeutic targets in SCLC. These include checkpoint kinases that are activated in response to DNA damage and facilitate S and G2 checkpoint arrest, such as Chk1 (Checkpoint kinase 1), Wee1, and ATR (Ataxia Telangiectasia and Rad3 related). Similar to PARP1, in our previous work we demonstrated elevated expression of Chk1 in SCLC[1]. SCLC may be particularly susceptible to inhibitors of Chk1 and other checkpoint kinases due to the near universal loss of TP53 in these cancers which make them dependent on other checkpoint controls in the cell cycle. Several drugs targeting these DDR proteins have entered clinical trials. For example, based on pre-clinical data demonstrating the potentiation of topoisomerase inhibitors by ATR inhibition, a Phase I/II trial of topotecan with VX970 (an ATR kinase inhibitor) has recently been initiated for SCLC (NCT02487095). Ongoing trials of PARP inhibitors and other molecules targeting DDR will help us to understand the activity of these compounds in patients with SCLC. Important questions that require further investigation include the optimal combinations of these drugs with existing therapies or other targeted inhibitors, strategies to manage associated toxicities (especially combinations with overlapping hematologic toxicities), and further development of candidate predictive biomarkers.REFERENCES 1. Byers LA, Wang J, Nilsson MB, et al. Proteomic profiling identifies dysregulated pathways in small cell lung cancer and novel therapeutic targets including PARP1. Cancer discovery 2012;2:798-811. 2. Owonikoko TK, Zhang G, Deng X, et al. Poly (ADP) ribose polymerase enzyme inhibitor, veliparib, potentiates chemotherapy and radiation in vitro and in vivo in small cell lung cancer. Cancer medicine 2014;3:1579-94. 3. Cardnell RJ, Feng Y, Diao L, et al. Proteomic markers of DNA repair and PI3K pathway activation predict response to the PARP inhibitor BMN 673 in small cell lung cancer. Clinical cancer research : an official journal of the American Association for Cancer Research 2013;19:6322-8. 4. Y. Feng, R. Cardnell, L.A. Byers, B. Wang, Y. Shen. Talazoparib (BMN 673) as single agent and in combination with temozolomide or PI3K pathway inhibitors in small cell lung cancer and gastric cancer models. 26th EORTC-NCI-AACR Symposium on Molecular Targets and Cancer Therapeutics (abstract) 2014. 5. Wainberg ZA, Ramanathan RK, Mina LA, Byers LA, Chugh R, Goldman JW, Sachdev JC, Matei DE, Wheler JJ, Henshaw JW, Zhang C, Gallant G, De Bono JS. Safety and antitumor activity of the PARP inhibitor BMN673 in a phase 1 trial recruiting metastatic small-cell lung cancer (SCLC) and germline BRCA-mutation carrier cancer patients. 2014 ASCO Annual Meeting; J Clin Oncol 32:5s, (suppl; abstr 7522) 2014. 6. Owonikoko TK, Dahlberg SE, Khan SA, et al. A phase 1 safety study of veliparib combined with cisplatin and etoposide in extensive stage small cell lung cancer: A trial of the ECOG-ACRIN Cancer Research Group (E2511). Lung cancer 2015;89:66-70. 7. Murai J, Huang SY, Das BB, et al. Trapping of PARP1 and PARP2 by Clinical PARP Inhibitors. Cancer research 2012;72:5588-99.

Abstract not provided

Abstract:
Small cell lung cancer (SCLC) comprises approximately 15% of all lung cancers, and it is an exceptionally aggressive malignancy with a high proliferative index. Despite extensive basic and clinical research over the past 30 years, little progress has been made in treating this disease. A better understanding of the genomic changes in SCLC is essential to identify new therapeutic targets. However, a systematic genomic analysis of SCLC is difficult because this cancer subtype is rarely treated surgically, resulting in the lack of suitable tumor specimens for comprehensive analysis. Two reports regarding the comprehensive genomic analysis of SCLC have been published. These reports suggested that transcriptional deregulation might play a role in SCLC biology[1,2]. However, to date, attempts to develop targeted therapies toward these transcriptional deregulations have had limited success. Recently, we performed a comprehensive genomic analysis of 51 surgical resected SCLCs and found a high penetrance of genetic alterations in the PI3K/AKT/mTOR pathway[3]. MYC family amplifications are known oncogenic drivers in SCLC. PI3K/AKT/mTOR pathway alterations and MYC family amplifications were mutually exclusive in this study (Figure 1). However, the information regarding therapeutically relevant genomic alterations in advanced non-surgical SCLC is not well developed; so we performed targeted sequencing from 90 advanced SCLC. We identified that the PI3K/AKT/mTOR pathway was frequently altered in advanced SCLC in the same way as surgically resected SCLC. In advanced SCLC, PI3K/AKT/mTOR pathway alterations and MYC family amplifications were also mutually exclusive. The genomic profile of advanced SCLC was almost similar to that of resectable SCLC. To further investigate whether the PI3K/AKT/mTOR pathway could be a feasible therapeutic target in SCLC, we performed the in vitro drug sensitivity test using PI3K/mTOR dual inhibitor: NVP-BEZ235. NCI-H1048 cells harboring activating mutation in PIK3CA gene (H1047R), was the most sensitive to BEZ235, with IC50 value of 5.4 nM. Additionally, PIK3CA silencing induced a significant decrease in the proliferation of H1048 cells, suggesting that the proliferation of these cells was strongly dependent on the PI3K/AKT/mTOR pathway[3]. On the other hand, PTEN is a tumor suppressor gene working in PI3K/AKT/mTOR pathway. In murine model, Pten deletion accelerated SCLC by engineered deletion of two tumor suppressors (Rb and p53), suggesting that Pten was an important driver of tumor progression in SCLC[4]. Unlike other types of cancer, this is a unique phenomenon observed in SCLC, therefore targeting of PTEN signaling is reasonable in SCLC. There are many other reports which suggest that PI3K/AKT/mTOR pathway is the promising therapeutic target in SCLC. Although two specific inhibitors of mTORC1, everolimus and temsirolimus, have been tested against SCLC in a Phase II study, the antitumor activity was limited in unselected patients. To improve the response to these inhibitors, biomarker-based patient selection is first recommended. Secondly, the addition of PI3K inhibition might improve the response to specific inhibitors of mTORC1. The dual inhibition of PI3K and mTOR might be advantageous over the single inhibition of mTOR because of the suppression of the S6K feedback loop, which leads to the pathway reactivation. PF-05212384 is a novel potent dual inhibitor of PI3K and mTOR, which has demonstrated preliminary evidence of clinical activity in patients with solid malignancies[5]. However, dual inhibitor of PI3K and mTOR has not yet to be evaluated against SCLC in a phase II study. Thus, we planned the investigator initiated phase II study to investigate the efficacy of PF-05212384 in advanced recurrent SCLC patients harboring PI3K/AKT/mTOR pathway alteration. Key eligibility criteria include: advanced SCLC, harboring PI3K/AKT/mTOR pathway alteration, prior chemotherapy, aged ≥ 20 years, and ECOG PS 0-2. The primary endpoint is objective response rate. Patients receive weekly intravenous dose of PF-05212384 154 mg until disease progression. For screening SCLC patients harboring PI3K/AKT/mTOR pathway alteration, we use the multiplex next-generation sequencing tool enabling the analysis of about 150 genes in a single run. SCLC harboring PI3K/AKT/mTOR pathway alteration is a “Rare Cancer”. Therefore, patient recruitment is performed using the nationwide lung cancer genomic screening program, LC-SCRUM-Japan. LC-SCRUM-Japan is the largest molecular screening system in Japan. At the end of June 2015, around 180 institutes in all prefectures of Japan are participating this screening program. The prospective genomic screening of SCLC will be started in July 2015. In conclusion, the SCLC genome possesses distinguishable genetic features in the PI3K/AKT/mTOR pathway. Genetic alterations in the PI3K/AKT/mTOR pathway were noted as a top therapeutic priority in SCLC. Investigator initiated phase II study of PF-05212384 in advanced recurrent SCLC patients harboring molecular alterations in PI3K/AKT/mTOR pathway is planned to be started in January 2016.Figure 1 References 1. Peifer M, Fernández-Cuesta L, Sos ML, et al. Integrative genome analyses identify key somatic driver mutations of small-cell lung cancer. Nature genetics 2012; 44: 1104-1110. 2. Rudin CM, Durinck S, Stawiski EW et al. Comprehensive genomic analysis identifies SOX2 as a frequently amplified gene in small-cell lung cancer. Nature genetics 2012; 44: 1111-1116. 3. Umemura S, Mimaki S, Makinoshima H, et al. Therapeutic priority of the PI3K/AKT/mTOR pathway in small cell lung cancers as revealed by a comprehensive genomic analysis. J Thorac Oncol 2014; 9: 1324-31. 4. McFadden DG, Papagiannakopoulos T, Taylor-Weiner A, et al. Genetic and clonal dissection of murine small cell lung carcinoma progression by genome sequencing. Cell 2014; 156: 1298-1311. 5. Shapiro GI, Bell-McGuinn KM, Molina JR, et al. First-in-Human Study of PF-05212384 (PKI-587), a Small-Molecule, Intravenous, Dual Inhibitor of PI3K and mTOR in Patients with Advanced Cancer. Clin Cancer Res. 2015; 21: 1888-1895.

Abstract:
Small cell lung cancer (SCLC), which accounts for 15 – 20% of all lung cancer cases, represents one of the most aggressive subtypes based on rapid growth and early metastasis. Only limited therapeutic progress has been achieved in the recent decades and despite multiple mutations no targeted therapy for SCLC has been available by now. Based on preclinical data that revealed a relevant correlation between the immune system and SCLC the exploration of immune modulating agents appears to be attractive. First signals coming from randomized phase II trials showed an enhanced activity for the combination of the anti cytotoxic T-lymphocyte antigen-4 (CTLA-4) antibody ipilimumab with chemotherapy compared to chemotherapy alone. This combination is now under investigation in a couple of extended randomised trials. Besides ipilimumab also antibodies inhibiting the axis of programmed cell death protein 1 (PD-1) and programmed cell death protein ligand 1 (PD-L1) like nivolumab or pembrolizumab have shown encouraging results either alone or in combination with ipilimumab in heavily pre-treated patients with advanced SCLC. Ongoin or planned randomised trials will validate these signals in various therapeutic lines. A confirmation of these attractive early outcomes would have an substantial clinical impact. In particular in SCLC identification of new potential biomarkers will become of great importance because the PDL-1 status might not be the optimal predictive marker in this tumor entity.

Abstract:
Introduction Small cell lung cancer (SCLC) represents approximately 13% of all lung cancer diagnoses and its incidence has reduced over the last 20 years, although the frequency is rising in women due to increased use of tobacco [1]. It is a highly malignant neuroendocrine tumor of the lung and treatment of SCLC remains challenging because of its rapid growth, early dissemination and development of drug resistance during the course of the disease [2]. Without treatment, SCLC has the most aggressive clinical course of any type of pulmonary tumor, with median survival from diagnosis of only 2 to 4 months [2]. With current chemotherapy regimens survival is prolonged, however, the overall survival at 5 years is only 5% to 10% [2]. Topotecan [3] is currently the only drug licensed in Europe and the Unites States for second-line treatment of SCLC, having been shown in a phase III trial to lead to longer overall survival and better quality of life than with best supportive care. In advanced SCLC, prognosis after failure of first-line treatment is very poor. No new targeted agents have shown meaningful benefit in this disease and, therefore, an urgent need exists for new active agents [4]. Cyclin Kinase Inhibitors Cyclin dependent kinases (CDK) belong to a family of serine/ threonine protein kinases that are associated with an activating cyclin regulatory subunit. CDKs are involved in the regulation of fundamental cellular processes such as cell division cycle and gene transcription. Cell-cycle CDKs 1, 2, 4, and 6 are required for the correct timing and order of the events of the cell-division cycle. CDK7 is a component of the CDK-activating complex that contributes to the assembly of CDK1/cyclin B. In addition, CDK7 functions as a transcriptional CDK, as well as CDKs 8 and 9, which have been shown to be involved in gene transcription via regulation of RNA polymerase II activity. Deregulated CDK activity results in loss of cell-cycle checkpoint function and increased expression of antiapoptotic proteins, which has been directly linked to the molecular pathology of cancer [5]. Roniciclib (BAY 1000394) is a CDK inhibitor with low nanomolar activity against cell-cycle CDKs and transcriptional CDKs. It was evaluated in cell line-derived and patient tumor derived SCLC xenograft models. The compound strongly reduced tumor growth with T/C values between 0.12 and 0.19 showing that roniciclib was similar or even more efficacious as compared with cisplatin (T/C values between 0.06 and 0.55) [6]. In vivo, studies showed that roniciclib has more than additive efficacy when combined with cisplatin and etoposide. This compound is currently under investigation in a double-blind, placebo controlled phase II CONCEPT-SCLC trial to assess the safety and efficacy of roniciclib in combination with etoposide and cisplatin or carboplatin as first line therapy in patients with extensive SCLC after results obtained in a multicenter phase I study that evaluated 25 pre-treated SCLC patients [7]. Aurora Kinase Inhibitors The aurora kinases (A, B, and C) are serine/threonine kinases that have a key role in mitosis; in particular, aurora kinase A is essential for centrosome function and maturation, spindle assembly, chromosome alignment, and mitotic entry. Aurora kinase A localizes to the centrosomes and spindle poles and recruits the cyclin B1–CDK1 complex. Inhibition of aurora kinase A leads to abnormal spindle formation, mitotic defects, and cell death. Overexpression or amplification of this enzyme has been noted across a range of different tumor types and is linked with tumor progression and poor prognosis. Thus, inhibition of aurora kinase A is a rational target for anticancer treatment [8]. Alisertib exhibits favorable pharmacokinetic parameters and displayed tumor growth inhibition [9]. In Phase I dose escalation studies with alisertib given orally on a twice daily schedule for seven consecutive days, the maximum tolerated dose was defined predominantly by the occurrence of grade 3 or grade 4 myelosuppression and stomatitis, consistent with the antiproliferative effects of Aurora A inhibition. In a phase II study, the small-cell lung cancer cohort (see figure 1), ten (21%; 95% CI 10–35) of 48 patients had an objective response to alisertib; all responders achieved a partial response. Response-assessable patients with small- cell lung cancer received a median of 2,5 cycles (range 1−21) of alisertib, with a median time on treatment of 1,5 months (range 0,1−11,7, IQR 0,9–3,7). The median duration of response was 4,1months (95% CI 3,1 not evaluable), median progression-free survival was 2,1 months (95% CI 1,4–3,4), and median time to progression was 2,6 months (95% CI 1,4–3,8). The adverse effects of alisertib were generally manageable and included anemia, fatigue, alopecia, and various gastrointestinal disorders, and consistent with those noted in earlier trials of alisertib. Neutropenia was the most frequent drug related grade 3–4 adverse event; however, febrile neutropenia was recorded much less frequently. The antitumor activity noted in the SCLC cohort in this study (objective response 21%) seems similar to that reported with the current standard of care, topotecan (objective response 7–24%) [3]. Although the initial signal of activity noted in both the chemotherapy sensitive relapse population and in patients with refractory and chemotherapy resistant relapse is encouraging, to achieve more meaningfully improved outcomes, combinations of alisertib with other anticancer drugs should be studied. A follow-up, randomized, global phase 2 trial of alisertib plus weekly paclitaxel versus placebo plus paclitaxel as second-line treatment for small cell lung cancer is currently enrolling. References [1] Youlden DR, et al. The International Epidemiology of Lung Cancer: Geographical Distribution and Secular Trends. Journal of Thoracic Oncology, Vol. 3, No. 8, 2008, pp. 819-831. [2] Govindan R, et al. Changing Epidemiology of Small-Cell Lung Cancer in the United States over the Last 30 Years: Analysis of the Surveillance, Epidemiologic, and End Results Database, Journal of Clinical Oncology, Vol. 24, No. 28, 2006, pp. 4539-4544. [3] Ormrod D and Spencer CM, Topotecan: A Review of Its Efficacy in Small Cell Lung Cancer, Drugs, Vol. 58, No. 3, pp. 533-551. [4] Joshi M, et al.. Small-cell lung cancer: an update on targeted therapies. Adv Exp Med Biol 2013; 779: 385–404. [5] Lapenna S,et al.. Cell cycle kinases as therapeutic targets for cancer. Nat Rev Drug Discov 2009;8:547–66. [6] Siemeister G, et al. . BAY1000394, a novel cyclin –dependent kinase inhibitor, with potent antitumor activity in mono and combination treatment upon oral application. Mol Cancer Ther, 2012 Oct 11 (10): 2285-73 [7] Bahleda R, et al. A first-in-human phase I study of oral pan-CDK inhibitor BAY 1000394 in patients with advanced solid tumors: Dose escalation with an intermittent 3 days on/4 days off schedule.. J Clin Oncol 30, 2012 (suppl; abstr 3012) [8] Bolanos-Garcia VM. Aurora kinases. Int J Biochem Cell Biol 2005; 37: 1572–77.
 [9] Sells TB, et al. MLN8054 and Alisertib (MLN8237): Discovery of Selective Oral Aurora A Inhibitors. ACS Med Chem Lett, 2015, 6, 630-4. [10] Melichar B, et al. Safety and activity of alisertib, an investigational aurora kinase A inhibitor, in patients with breast cancer, small-cell lung cancer, non-small-cell lung cancer, head and neck squamous-cell carcinoma, and gastro-oesophageal adenocarcinoma: a five-arm phase 2 study. Lancet Oncol, Vol16 April2015, 305-405 Figure 1

Abstract:
Small cell lung cancer (SCLC) accounts for nearly 15% of newly diagnosed lung cancers.[1] With the advent of tyrosine kinase inhibitors, the last decade has witnessed remarkable improvements in the outcomes of patients with non-small cell lung cancer (NSCLC). However, outcomes in patients with SCLC continue to remain dismal. Currently approved targeted therapies have minimal role in the management of SCLC, since unlike NSCLC, targetable tyrosine kinase alterations are rarely witnessed in SCLC.[2,3] Cytotoxic chemotherapy has therefore continued to remain the standard of care for SCLC. SCLC is usually very sensitive to first-line platinum based therapies.[4] Nevertheless, these responses are seldom durable and majority of patients relapse within weeks to months of treatment completion. Relapsed SCLC is a tough disease to treat and barely responds to conventional therapies. There is hence is an urgent need to develop novel therapeutic strategies that are capable of improving survival in patients with SCLC - particularly those with relapsed disease. Several new chemotherapeutic agents are currently being developed and actively studied in various solid tumors. The objective of this article is to highlight some of these newer chemotherapies and discuss their potential relevance in the management of SCLC. Eribulin mesylate is a non-taxane halichondrin B analogue derived from the marine sponge Halichondria okadaic.[5] Eribulin sequesters tubulin and inhibits mitotic spindle formation, leading to cell cycle arrest in G2-M and eventually cell death. Eribulin is currently FDA approved in the United States for the management of metastatic breast cancer in patients receiving prior treatment with at least two chemotherapy regimens, including an anthracycline and a taxane. In the phase III EMBRACE trial, as a part of which 762 women with breast cancer were randomized to receive eribulin or chemotherapy of the treating physician’s choice, overall survival (OS) was significantly improved with eribulin (13.1 vs. 10.6 months, HR 0.81 p=0.041).[6] Eribulin as single agent and in combination with erlotinib were shown to be active and well tolerated in patients with NSCLC treated with prior platinum based therapies.[7] In the study by Spira and colleauges, eribulin was dosed at 1.4mg/m2 on days 1 and 8 of a 21 day cycle (similar to breast cancer dosing schedule) and in a second cohort of patients at 1.4 mg/m2 on days 1, 8 and 15 of a 28 day schedule.[8] Among these, the 21 day dosing schedule was shown to be better tolerated and active with a median OS of 9.4 months in the second line setting for NSCLC. However, when used in combination with a second agent, the maximum tolerated dose (MTD) of eribulin was much lower. In a phase Ib/II study involving pretreated NSCLC patients, the MTD of eribulin was 0.9mg/m2, with 500mg/m2 of pemetrexed, administered on day 1 of a 21 day cycle.[9] Unfortunately, the combination was tolerable but showed no therapeutic benefit at this dose. Aldoxorubicin, formerly known as INNO-206, combines a molecular linker that allows doxorubicin to bind covalently to serum albumin upon intravenous administration.[10] This formulation releases doxorubicin in the acidic tumor microenvironment. Aldoxorubicin is currently being actively investigated in the management of soft-tissue sarcomas and glioblastoma. In a phase Ib/II study by Chawla and colleagues, the MTD of aldoxorubicin was 350mg/m2 administered every 21 days.[11] The drug showed a partial response rate of 20% and stable disease rate of 40% in 25 patients with advanced chemotherapy refractory cancers, among which most patients (68%) had soft tissue sarcomas. Aldoxorubicin was considered to be safe and efficacious in these patients. Currently, aldoxorubicin is being studied as part of an ongoing randomized phase IIb trial in patients with relapsed/refractory SCLC (NCT02200757). This study will compare progression free survival (PFS) between patients receiving aldoxorubicin at a dose of 230mg/m2 every 21 days, with those receiving topotecan. Irinotecan is a chemotherapeutic agent known to be active in SCLC. SN38 is the active metabolite of irinotecan, which through its inhibitory action on DNA topoisomerase I induces DNA breaks and inhibits repair. Etirinotecan pegol is a formulation designed to provide prolonged systemic exposure to SN38.[12] In a phase I dose escalation study, 66 patients received etirinotecan on three different dosing schedules and 115mg/m2 administered on days 1, 8 and 15 of 21 day cycles was established as the MTD. Diarrhea was observed in 5 patients at the 115mg/m2 dose level, with one patient experiencing grade 3 or higher diarrhea. The cholinergic diarrhea that is seen with irinotecan was not observed with etirinotecan. The drug was also shown to induce partial responses in patients with various cancers including SCLC. Etirinotecan was also recently reported to be active in heavily pretreated ovarian cancer patients.[13] In this study etirinotecan was administered at 145mg/m2 every 14 or 21 days, and the 21 day dosing schedule was found to be better tolerated and selected for further study. A phase II study that plans to study the effect of etirinotecan dosed every 21 days on PFS in patients with relapsed SCLC is currently recruiting (NCT01876446). Another formulation of irinotecan, MM-398, which is a nanoliposomal encapsulated formulation that packs nearly 80,000 irinotecan molecules in a 100nm liposome, is also being actively investigated in pancreatic, gastrointestinal, and other solid tumors.[14] Results from the NAPOLI-1 trial, a phase III study in which patients with metastatic pancreatic cancer who were previously treated with gemcitabine, were randomized to receive either single agent MM-398 at 120mg/m2 every 3 weeks or a combination of 5-fluorouracil (5FU), leucovorin (LV) and MM-398 at 80mg/m2, or 5-FU/LV alone, were recently presented.[15] The primary objective of this study was OS and in the intention to treat analysis, this was significantly improved in the MM-398/5FU/LV combination arm compared to the 5FU/LV arm (median OS 6.1 months vs. 4.2 months, HR-0.57, p=0.0009). Although there is currently no clinical data regarding the efficacy or safety of these newer drugs in patients with SCLC, considering that taxanes, anthracyclines, and DNA topoisomerase inhibitors are each individually active in SCLC, and that newer agents such as these have shown some positive preliminary results in other cancers - there is hope and optimism that over the next few years we will witness substantial progress in the management of SCLC. Overall, the need for developing and implementing well-designed biomarker driven clinical studies to investigate the role of these and other novel agents in SCLC is now greater than ever. References 1. Govindan R, Page N, Morgensztern D, et al. Changing epidemiology of small-cell lung cancer in the United States over the last 30 years: analysis of the surveillance, epidemiologic, and end results database. J Clin Oncol 2006;24:4539-44. 2. Rudin CM, Durinck S, Stawiski EW, et al. Comprehensive genomic analysis identifies SOX2 as a frequently amplified gene in small-cell lung cancer. Nat Genet 2012;44:1111-6. 3. Peifer M, Fernández-Cuesta L, Sos ML, et al. Integrative genome analyses identify key somatic driver mutations of small-cell lung cancer. Nat Genet 2012;44:1104-10. 4. Kalemkerian GP, Akerley W, Bogner P, et al. Small cell lung cancer. J Natl Compr Canc Netw 2013;11:78-98. 5. Scarpace SL. Eribulin mesylate (E7389): review of efficacy and tolerability in breast, pancreatic, head and neck, and non-small cell lung cancer. Clin Ther 2012;34:1467-73. 6. Cortes J, O'Shaughnessy J, Loesch D, et al. Eribulin monotherapy versus treatment of physician's choice in patients with metastatic breast cancer (EMBRACE): a phase 3 open-label randomised study. Lancet 2011;377:914-23. 7. Mok TS, Geater SL, Iannotti N, et al. Randomized phase II study of two intercalated combinations of eribulin mesylate and erlotinib in patients with previously treated advanced non-small-cell lung cancer. Ann Oncol 2014;25:1578-84. 8. Spira AI, Iannotti NO, Savin MA, et al. A phase II study of eribulin mesylate (E7389) in patients with advanced, previously treated non-small-cell lung cancer. Clin Lung Cancer 2012;13:31-8. 9. Waller CF, Vynnychenko I, Bondarenko I, et al. An open-label, multicenter, randomized phase Ib/II study of eribulin mesylate administered in combination with pemetrexed versus pemetrexed alone as second-line therapy in patients with advanced nonsquamous non-small-cell lung cancer. Clin Lung Cancer 2015;16:92-9. 10. Kratz F. A clinical update of using albumin as a drug vehicle - a commentary. J Control Release 2014;190:331-6. 11. Chawla SP, Chua VS, Hendifar AF, et al. A phase 1B/2 study of aldoxorubicin in patients with soft tissue sarcoma. Cancer 2015;121:570-9. 12. Jameson GS, Hamm JT, Weiss GJ, et al. A multicenter, phase I, dose-escalation study to assess the safety, tolerability, and pharmacokinetics of etirinotecan pegol in patients with refractory solid tumors. Clin Cancer Res 2013;19:268-78. 13. Vergote IB, Garcia A, Micha J, et al. Randomized multicenter phase II trial comparing two schedules of etirinotecan pegol (NKTR-102) in women with recurrent platinum-resistant/refractory epithelial ovarian cancer. J Clin Oncol 2013;31:4060-6. 14. Saif MW. MM-398 achieves primary endpoint of overall survival in phase III study in patients with gemcitabine refractory metastatic pancreatic cancer. JOP 2014;15:278-9. 15. Dhindsa N, Bayever E, Li C, et al. NAPOLI-1: randomized phase 3 study of MM-398 (nal-iri), with or without 5-fluorouracil and leucovorin, versus 5-fluorouracil and leucovorin, in metastatic pancreatic cancer progressed on or following gemcitabine-based therapy. Annals of Oncology (2014) 25 (suppl_2): ii105-ii117. 10.1093/annonc/mdu193.

Abstract:
The most common epidermal growth factor receptor (EGFR) mutations identified in lung adenocarcinomas – termed classic somatic EGFR kinase domain mutations – occur as small inframe deletion (indels) mutations within exon 19 (45% of EGFR mutations, the most common delE746_A750) or the exon 21 L858R (40% of EGFR mutations) point mutation. Tumors harboring these classic EGFR mutations become addicted to EGFR’s signaling cascades and are susceptible (i.e., have a favorable therapeutic window) to inhibition by ATP-mimetic reversible (1[st] generation) EGFR tyrosine kinase inhibitors (TKIs) and C797-covalent (either wild-type specific [2[nd] generation] or mutation specific [3[rd] generation]) EGFR TKIs. EGFR-exon 19 deletions or EGFR-L858R are predictors of radiographic response and progression-free survival when gefitinib, erlotinib (1[st] generation) and afatinib (2[nd] generation) are used for patients with advanced lung adenocarcinomas. These anti-cancer compounds are approved by regulatory agencies and have revolutionized evidence-based care of advanced lung cancer. However, the palliative benefits of these drugs are limited by acquired mechanisms of tumor resistance, such as the gatekeeper EGFR-T790M mutation (which in turn can be inhibited by 3[rd] generation TKIs: mereletinib/AZD9291 and rociletinib. Both of these drugs are undergoing rapid development as palliative therapies for EGFR exon 19 deletion or L858R plus T790M mutated lung cancer and will soon be approved for evidence-based clinical care). The median survival of patients with EGFR-exon 19 deleted or EGFR-L858R mutated lung adenocarcinomas usually exceeds 24-36 months with a substantial portion of patients living for longer than 3 years when given sequential EGFR TKI therapy plus evidence-based cytotoxic chemotherapy. Consistently, patients with EGFR exon 19 deletion mutated lung adenocarcinomas have improved outcomes on 1[st] and 2[nd] generations EGFR TKIs than those with L858R mutated tumors (for biological and clinical reasons that remain to be elucidated). Other EGFR mutations have also been linked in preclinical models and in patients with lung adenocarcinomas to sensitivity to 1[st] and 2[nd] generation EGFR inhibitors. These include exon 18 point mutations in position G719 (G719A, C or S [3% of EGFR mutations]), inframe exon 19 insertions (1% of EGFR mutations), the exon 20 S768I mutation (<1% of EGFR mutations) and the exon 21 L861Q mutation (2% of EGFR mutations). Since most data for response to EGFR TKIs for these less frequent EGFR mutated lung adenocarcinomas comes from retrospective studies or single center experience; the true response rate, progression-free survival and overall survival of these tumors when given gefitinib, erlotinib, afatinib and 3[rd] generation EGFR TKIs is not clear. Interestingly, G719X, L858R and L861Q TKI-sensitive mutations can be commonly identified in conjunction (i.e., complex/compound mutations in >15% of cases) with other less well-defined EGFR kinase domain mutations (such as E709X, L747X, S768X, R776X, T790M, A871G, among others); and these double mutations may affect some of the single mutant pattern of response to EGFR TKIs. In the absence of formal regulatory approval for G719X, exon 19 inserted and L861Q mutated lung adenocarcinomas (groups that comprise more than 5% of all EGFR mutated tumors), the use of EGFR TKIs is often provided as “off label therapy” with clinical management similar to EGFR-exon 19 deletions or EGFR-L858R mutated lung adenocarcinomas. How often EGFR-T790M emerges as a mechanism of resistance in these tumors is unclear. The third most common and most diverse group of EGFR mutations are EGFR exon 20 insertions mutations (up to 10% of all EGFR mutations), which usually occur near the end of the C-helix within the N-lobe of the kinase, after residue M766 up to amino-acid C775, but a small subset map to the middle of the C-helix affecting amino-acids E762 to Y764. Unlike the other aforementioned EGFR mutated lung adenocarcinomas, most tumors with EGFR exon 20 insertion mutations are insensitive (i.e., do not respond radiographically or clinically) to 1[st] and 2[nd] generation EGFR TKIs; with the exception of EGFR-A763_Y764insFQEA (identical to D761_E762insEAFQ and with structural homology similar to exon 21 single mutants by inducing a N-terminal shift in the C-helix while replacing the active site residue E762 of EGFR), where responses to 1[st] and 2[nd] generation EGFR TKIs arise. Preclinical models – that mirror clinical behavior – have convincingly demonstrated that Y764_V765insHH, M766_A767insAI, A767_V769dupASV, D770_N771insNPG, D770_N771insSVD and H773_V774insH are not inhibited by clinically-achievable doses of gefitinib, erlotinib or afatinib. The structure of D770_N771insNPG (a representative EGFR TKI-insensitive exon 20 mutation at the most common insertion position D770_N771) has disclosed the amino acids inserted lock the helix in its active position but don’t alter the kinase domain TKI biding pocket (i.e., these mutants lack a therapeutic window to TKIs when compared to wild-type). Therefore, EGFR exon 20 insertion mutations affecting amino-acids Y764 to V774 should be classified as non-sensitizing to EGFR TKIs and development of mutation-specific TKIs may be hampered by the lack of therapeutic window of the kinase domain when compared to wild-type EGFR. Most EGFR exon 20 insertion mutated lung adenocarcinomas – in lieu of innovative clinical trials – should be treated with evidence-based approaches for “oncogene negative” lung adenocarcinomas. In conclusion, EGFR mutations comprise a heterogeneous group of activating oncogene mutations that have become the most clinically-relevant “driver” oncogenes for the clinical care of lung adenocarcinomas.

Abstract:
Chromosomal rearrangements involving the ALK, ROS1, RET, and NTRK1 tyrosine kinases with several different gene fusion partners have been identified as therapeutically actionable genomic alterations in collectively up to 10% of non-small cell lung cancer (NSCLC) [1-4]. Notably, these kinase fusions have also been detected in several other epithelial, hematologic, neural, and mesenchymal malignancies, underscoring the importance of understanding fusion kinase biology in order to develop the most effective therapeutic strategies. In fact, numerous studies have now shown that tumors which harbor ALK, ROS1, RET, or NTRK1 fusions exhibit a dependency on the activated tyrosine kinase for proliferation and survival. This dependency, or ‘oncogene addiction’, makes the cancer highly sensitive to small molecule tyrosine kinase inhibitors (TKIs). In particular, ALK serves as the paradigm for therapeutically targetable kinase fusions in NSCLC. Crizotinib was the first ALK TKI to be approved for treatment of patients with ALK fusion positive (ALK+) NSCLC. Several other ALK TKIs, including ceritinib, alectinib, X-396, brigatinib, ASP3026, and PF-06463922 are also being developed for the treatment of ALK+ malignancies. These ‘next-generation’ ALK TKIs typically have more on-target efficacy against the ALK kinase domain and are able to overcome some of the crizotinib resistance mutations which have been observed clinically. While much emphasis has been placed on the study of the tyrosine kinase portion of ALK, ROS1, RET, and NTRK1 fusions, less is known about the 5’ gene fusion partners. However, the biology of the 5’ gene fusion partner is essential for driving the expression and function of the kinase fusion. Numerous different 5’ gene partners have been identified for each of the kinase fusions in NSCLC (Table 1). For example, EML4 is the most common fusion partner for ALK in NSCLC; however, KIF5B, TFG, KLC1, PTPN3, STRN, and SQSTM1 have also been identified as ALK partner genes in this disease. To add to the complexity, more than 10 different EML4-ALK fusions have been detected in NSCLC, varying by the extent of the EML4 gene which is fused to ALK. Likewise, numerous gene fusion partners have been described for ROS1, RET, and NTRK1 fusions in lung cancer (Table 1). Although the fusion partners can vary, they share three basic features. First, the promoter of the 5’ fusion partner dictates the expression of the fusion. Second, most fusion partners contribute an oligomerization domain, which can aid in auto-activation of the kinase [5]; although, this has not been verified for all fusion partners. The most common oligomerization domain found in the fusion partners is the coiled-coil domain. EML4-ALK homodimerizes by virtue of a coiled-coil domain in EML4. Disruption of this domain abrogates the ability of EML4-ALK to transform cells [5]. Furthermore, the extent of oligomerization may be important for transformation; some fusions dimerize, trimerize [6], or form tetramers [7]. Lastly, the 5’ gene fusion partner also determines subcellular localization of the fusion, and this can have significant effects on the interaction of the kinase fusion with other cellular proteins, influencing activation, signaling, function, and degradation of the fusion. For example, a thorough structural analysis of the most common EML4-ALK variants found in lung cancer revealed differences in the variant’s function, localization, and sensitivity to HSP90 inhibitors in clinical use [6]. Additionally, for some fusions, subcellular localization controls fusion activation, as is the case for MSN-ALK which congregates at the plasma membrane [8]. While most ALK fusions appear pan-cytoplasmic, others like RANBP2-ALK (perinuclear) and NPM-ALK (nuclear, nucleolar, and cytoplasmic) have different localization, the effects of which have yet to be investigated [9]. Very little is known about how signaling downstream of an ALK fusion may differ from that of a ROS1 or RET fusion in lung cancer. In addition, how different gene fusion partners may affect downstream signaling from a specific kinase fusion also remains an open question. One provocative study of various ALK fusions found in anaplastic large cell lymphoma demonstrated that the fusions were differentially able to activate PI3K and JAK-STAT signaling [10]. Furthermore, the ability of the different ALK fusions to activate PI3K kinase activity correlated with the fusion’s transendothelial migration properties. Overall, this study supports the hypothesis that the specific fusion gene partner defines the activity, signaling specificity, and phenotypic properties of the kinase fusion. Notably, the most commonly employed clinical diagnostics used to detect kinase fusions, including immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH), will not specify which fusion partner is present within a tumor. However, as more sophisticated next-generation sequencing technologies come to the forefront of clinical diagnostics, clinicians will not only know that a tyrosine kinase fusion is present, but also to which specific gene partner the kinase is fused At present, there is very little data, all retrospective, to address the question of how a different fusion partner may affect clinical outcomes and disease responsiveness to targeted therapies. This is largely because the trials have used methods, such as IHC and FISH, to define eligibility criteria. In-depth contextual studies in pre-clinical models of lung cancer and in clinical trials in patients with kinase fusion positive disease are lacking; however, further analysis of this issue will allow us to refine the treatment of fusion positive lung cancer on a more personalized level in order to more effectively inhibit tumor growth and understand potential therapeutic resistance mechanisms. References 1. Kwak, E.L., et al., Anaplastic lymphoma kinase inhibition in non-small-cell lung cancer. N Engl J Med, 2010. 363(18): p. 1693-703. 2. Shaw, A.T., et al., Crizotinib in ROS1-rearranged non-small-cell lung cancer. N Engl J Med, 2014. 371(21): p. 1963-71. 3. Drilon, A., et al., Response to Cabozantinib in patients with RET fusion-positive lung adenocarcinomas. Cancer Discov, 2013. 3(6): p. 630-5. 4. Vaishnavi, A., et al., Oncogenic and drug-sensitive NTRK1 rearrangements in lung cancer. Nat Med, 2013. 19(11): p. 1469-72. 5. Soda, M., et al., Identification of the transforming EML4-ALK fusion gene in non-small-cell lung cancer. Nature, 2007. 448(7153): p. 561-6. 6. Richards, M.W., et al., Microtubule association of EML proteins and the EML4-ALK variant 3 oncoprotein require an N-terminal trimerization domain. Biochem J, 2015. 467(3): p. 529-36. 7. Zhao, X., et al., Structure of the Bcr-Abl oncoprotein oligomerization domain. Nat Struct Biol, 2002. 9(2): p. 117-20. 8. Tort, F., et al., Molecular characterization of a new ALK translocation involving moesin (MSN-ALK) in anaplastic large cell lymphoma. Lab Invest, 2001. 81(3): p. 419-26. 9. Chiarle, R., et al., The anaplastic lymphoma kinase in the pathogenesis of cancer. Nat Rev Cancer, 2008. 8(1): p. 11-23. 10. Armstrong, F., et al., Differential effects of X-ALK fusion proteins on proliferation, transformation, and invasion properties of NIH3T3 cells. Oncogene, 2004. 23(36): p. 6071-82.

Table 1: Spectrum of tyrosine kinase fusions detected to date in NSCLC

Kinase	Gene Fusion partner
ALK	EML4
	KIF5B
	KLC1
	PTPN3
	SQSTM1
	STRN
	TFG
NTRK1	CD74
	MPRIP
ROS1	CCDC6
	CD74
	CLTC
	EZR
	FIG
	GOPC
	LIMA
	LRIG3
	MSN
	SDC4
	SLC34A2
	TPM3
RET	CCDC6
	CUX1
	KIAA1468
	KIF5B
	NCOA
	TRIM33

Abstract not provided

Abstract:
KRAS mutations are the most commonly detected mutation in non-small cell lung cancer (NSCLC). KRAS mutations encode proteins containing a single amino acid substitution and in NSCLC most mutations are in codons 12 and 13. KRAS mutant proteins are constitutively activated leading to stimulus independent activation of the RAF-MEK-ERK pathway. KRAS mutations are associated with a history of tobacco use, and are more common in adenocarcinoma than in squamous histology. Patients with history of never smoking have a higher rate of transition mutations, but the biological and clinical significance is unknown.[1]KRAS mutations are mutually exclusive with EGFR mutations and ALK and ROS1 rearrangements. The benefits of testing for KRAS mutations are to eliminate the need for further molecular testing and to enroll patients in trials investigating KRAS directed therapy. KRAS mutational status is predictive of benefit of anti-EGFR monoclonal antibodies in advanced colorectal cancer (CRC), and the benefit is restricted to patients with KRAS wild-type CRC. However, patients with metastatic CRC with KRAS G13D mutations have better prognosis and benefit from monoclonal antibodies demonstrating that the specific KRAS mutation may have clinical implications.[2]KRAS mutational status is not predictive of benefit of cetuximab in advanced NSCLC.[3] The frequency and distribution of KRAS mutation subtype differs significantly among different cancer types. KRAS mutations can activate multiple downstream signaling pathways and activation of signaling pathways may be cancer-specific. The implication is that the success and failures of targeted agents against KRAS pathway in other cancers may not be relevant for the development of KRAS pathway targeting agents in NSCLC. A target therapy is not currently available for KRAS mutant NSCLC, and the recent focus has been on the development of MEK inhibitors. A randomized phase II trial of docetaxel alone or with selumetinib revealed that patients assigned to the selumetinib arm experienced a statistically significant higher objective response rate (ORR) (37% vs. 0%, p<0.0001) and longer progression-free survival (PFS) (hazard ratio of 0.58, 80% CI, 0.42-0.79, p=0.014; median 5.3 and 2.1 months respectively) and a numerically longer overall survival (OS) (HR of 0.80, 80% CI, 5.6 to 1.14, p=0.21; median 9.4 and 5.2 months, respectively).[4] A phase II trial compared trametinib to docetaxel in patients with KRAS mutant NSCLC. The ORR was same in the two treatment arms (12%), and the PFS similar (HR of 1.14; 95% CI, 0.75 to 1.75; p=0.5197).[5,6] Trametinib was also investigated in two separate phase IB/II trials in combination with docetaxel or pemetrexed; patients with both KRAS mutant and wild-type NSCLC were enrolled. Patients with KRAS mutant and wild-type NSCLC had similar ORR and PFS raising the question if KRAS mutations are predictive of MEK inhibitor benefit. In a subset analysis of the trial of trametinib and docetaxel patients with KRAS G12C mutations (n=8) had an ORR of 40% and a disease control rate of 80%.[7] This subset analysis is hypothesis generating and illustrates the need to collect the specific KRAS mutations in trials of novel agents. The prognostic and predictive value of KRAS mutations was investigated in a pooled analysis of resected patients enrolled in adjuvant chemotherapy trials.[8] In the observation cohort no difference OS based KRAS mutational status or subtype was observed, and KRAS mutation status and mutation subtype was not prognostic. In the adjuvant chemotherapy cohort no significant OS benefit was observed among patients with KRAS wild-type and KRAS codon 12 mutant NSCLC; a detrimental effect of adjuvant chemotherapy on OS was observed among the 24 patients with KRAS codon 13 mutant NSCLC (HR of 5.78; 95% CI, 2.06-16.2; p<0.001; interaction p=0.002). This observation needs to be prospectively validated in a larger sample before being used to make decisions about the adjuvant chemotherapy. Preclinical data suggest that the presence or absence other mutations other than KRAS may impact the efficacy of selumetinib.[9]KRAS mutations are frequently found in patients with a significant smoking history, and tobacco related NSCLC is associated high rate of mutations.[10] Thus, the potential impact of concurrent mutations or molecular alterations should be considered in future investigations. 1. Dogan S, Shen R, Ang DC, et al: Molecular epidemiology of EGFR and KRAS mutations in 3,026 lung adenocarcinomas: higher susceptibility of women to smoking-related KRAS-mutant cancers. Clin Cancer Res 18:6169-77, 2012 2. De Roock W, Jonker DJ, Di Nicolantonio F, et al: Association of KRAS p.G13D mutation with outcome in patients with chemotherapy-refractory metastatic colorectal cancer treated with cetuximab. JAMA 304:1812-20, 2010 3. O'Byrne KJ, Gatzemeier U, Bondarenko I, et al: Molecular biomarkers in non-small-cell lung cancer: a retrospective analysis of data from the phase 3 FLEX study. Lancet Oncol 12:795-805, 2011 4. Janne PA, Shaw AT, Pereira JR, et al: Selumetinib plus docetaxel for KRAS-mutant advanced non-small-cell lung cancer: a randomised, multicentre, placebo-controlled, phase 2 study. Lancet Oncol 14:38-47, 2013 5. Blumenschein GR, Smit EF, Planchard D, et al: MEK114653: A randomized, multicenter, phase II study to assess efficacy and safety of trametinib (T) compared with docetaxel (D) in KRAS-mutant advanced non–small cell lung cancer (NSCLC). Journal of Clinical Oncology 31:abstract 8029, 2013 6. Kelly K, Mazieres J, Leighl NB, et al: Oral MEK1/MEK2 inhibitor trametinib (GSK1120212) in combination with pemetrexed for KRAS-mutant and wild-type (WT) advanced non-small cell lung cancer (NSCLC): A phase I/Ib trial. Journal of Clinical Oncology 31:abstract 8027, 2013 7. Gandara DR, Hiret S, Blumenschein GR, et al: Oral MEK1/MEK2 inhibitor trametinib (GSK1120212) in combination with docetaxel in KRAS-mutant and wild-type (WT) advanced non-small cell lung cancer (NSCLC): A phase I/Ib trial. Journal of Clinical Oncology 31:abstract 8028, 2013 8. Shepherd FA, Domerg C, Hainaut P, et al: Pooled analysis of the prognostic and predictive effects of KRAS mutation status and KRAS mutation subtype in early-stage resected non-small-cell lung cancer in four trials of adjuvant chemotherapy. J Clin Oncol 31:2173-81, 2013 9. Chen Z, Cheng K, Walton Z, et al: A murine lung cancer co-clinical trial identifies genetic modifiers of therapeutic response. Nature 483:613-7, 2012 10. Lawrence MS, Stojanov P, Polak P, et al: Mutational heterogeneity in cancer and the search for new cancer-associated genes. Nature 499:214-8, 2013

Background:
Anlotinib is a multi-target RTK inhibitor, especially on VEGFR2/3, EGFR, c-Kit, PDGF, FDFR, c-MET, with highly selective inhibition effect. This phase II study was to investigate efficacy and safety of anlotinib in refractory NSCLC patients

Methods:
Patients ≥18 years with metastatic or recurrent advanced NSCLC and ECOG status of 0–1 were randomized 1:1 to receive Anlotinib or placebo (Anlotinib 12mg/day, po, day 1-14 each 3-week) until progression, unacceptable toxicity, withdrawal or death. Patients had received first and second line treatment for advanced NSCLC. Patients were stratified by gender, smoking status and age. We used RECIST (version 1.1) criteria to assess response and progression. Primary endpoint was PFS in ITT population; secondary endpoints included ORR, OS, biomarkers and safety.

Results:
From Aug. 2013 to May 2014, we enrolled 117 patients from 13 centers, including 60 patients to anlotinib arm and 57 patients to placebo. Baseline characteristics were similar in both treatment groups. PFS was prolonged with anlotinib 4.83 month vs placebo 1.23 months (HR 0.32, 95% CI 0.20–0.51, p<0.0001). ORR was improved with addition of anlotinib: 10% vs 0% with placebo (p<0.027).DCR was 83.3% with anlotinib vs 31.5% with placebo (p<0.0001). mOS was prolonged with Anlotinib 10.33 months vs placebo 6.3 months. (HR, 0.656; 95% CI, 0.411 to 1.048; P = 0.0776; Cutoff date: April 12, 2015. This mOS is an estimated data, OS events for both arms still not reach 75%). OS rate of >12 months is 22.8% in placebo arm and 38.3% in anlotinib arm. AEs occurred more frequently with anlotinib than placebo; the most common AEs of any grade were hypertension (53.33%), increased TSH (36.67%), hand foot syndrome (28.33%), increased TG (26.67%), increased TC (25%), cough (21.67%), diarrhea (21.67%), increased LDL (16.67%), hemoptysis (16.67%) oral mucositis (13.33%), and sore throat (13.33%). Grade III/IV treatment-related AEs increased 16.4% in anlotinib group (anlotinib: 21.6% , placebo: 5.3%, p=0.0140).

Conclusion:
This study confirms that anlotinib to third-line platinum-based chemotherapy appears to provide significant PFS benefits in Chinese patients with refractory advanced NSCLC compared with placebo. No serious safety concerns were reported in the study.

Background:
EGFR Exon20 mutations have been considered to be markers of acquired resistance to Tyrosine Kinase inhibitors. The association between Oral TKI response and Baseline Exon20 Mutations has not been addressed in many studies and remains to be evaluated.

Methods:
We conducted a retrospective audit of our prospectively maintained Lung cancer audit database in our institute in the year 2014.We reviewed data related to EGFR mutation testing by RQ-PCR using endpoint genotyping assay for EXON 20, 19, 21.We also reviewed data relating to baseline demographics,clinical profile, patient treatment and outcome measures in terms of response and survival.

Results:
We reviewed 807 sequentially tested lung cancer patients, who underwent molecular testing using RQ-PCR by endpoint genotyping assay. The overall mutation rate was 26.4% and 19 (2%) had baseline EGFR EXON20 mutation. The median age of patients was 56yrs [range: 29-81yrs], with 7 patients being females .There were 7 patients who gave past history of smoking. The most common site of metastasis was pleural effusion in 8,followed by Bone in 6,Brain in 5 and Liver metastasis in 2patients.Histology was adenocarcinoma in majority[16 patients].Among the types of EXON20 Mutations, 7 patients had S7681, 4 patients had INSGGT, 5patients had INS 9 and 4 patients had T790M mutation. All patients received chemotherapy as first line treatment. We have documented response assessment at 2months in 8 patients with progressive disease in 5[63%], stable disease in 2 and partial response in 1 patient. Second line therapy with Oral TKI was given to 9 patients, in whom we have documented response assessment in 6, all of whom had progressed.The median Overall survival of Exon-20 mutation positive patients was 5.5months. [Range of 3.8-7.2months], in comparison with other types of EGFR mutations which showed median Overall survival of 16.3months[range:12.7-19.4months

Conclusion:
EXON-20 Mutations in general proclaim grave prognosis, predicting limited benefit of chemotherapy and marked TKI resistance.

Background:
Lung cancers harboring common EGFR mutations respond to EGFR tyrosine kinase inhibitors (TKIs),whereas exon 20 insertions (Ins20) are known to be resistant to these drugs. However, little is known about the role of mutations in exon 18. Inspired by clinical observation that a patient with adenocarcinoma harboring exon 18 deletion (Del18: delE709_T710insD) responded to afatinib, this study aimed to establish a rational therapeutic strategy for lung cancers harboring exon 18 mutations.

Methods:
The mutational status of lung cancers registered in Aichi Cancer Center (ACC) database between 2001 and 2015 was reviewed. Three representative mutations in exon 18, Del18, E709K, and G719A, were introduced into Ba/F3, NIH3T3, and HEK293 cells using retroviral vector. The 90% inhibitory concentrations (IC90s) of first generation (1G) (gefitinib and erlotinib), second generation (2G) (afatinib, dacomitinib, and neratinib), and third generation (3G) TKIs (AZD9291 and CO1686) in these cells were determined and compared with the corresponding IC90s in cells expressing exon 19 deletion (Del 19) and with the trough concentration (C~trough~) at the recommended doses for each drug. Clinical data on the treatment response of tumors harboring exon 18 mutations were collected from the ACC and Catalogue of Somatic Mutations in Cancer (COSMIC) databases.

Results:
Among the 1355 EGFR mutations registered in the ACC database, Del19, L858R, and Ins20 were detected in 40%, 47%, and 4%, respectively. Of note, exon 18 mutations including G719X, E709X, and Del18 were present in 3.2% (n=43), accounting for 38% of the remaining. According to the COSMIC database, exon 18 mutations accounted for 4.1% (654/16,138) of all EGFR mutations present from exons 18-21. Mutations at codons 709 and 719 accounted for 84% of all exon 18 mutations. Ba/F3 cells expressing Del18, E709K, or G719A grew in the absence of interleukin 3, and NIH3T3 cells transfected with these mutations formed foci with marked pile-up, indicating that these mutations act as oncogenic drivers. IC90s of 1G and 3G TKIs in cells transfected with Del18, E709K and G719A were much higher than those in cells transfected with Del19 (by >50-, >25-, and >11-fold, respectively). In contrast, IC90 of afatinib in these three mutations ranged from only 2- to 6-fold greater than that in Del19 and was <1/40 of its C~trough~. Notably, cells transfected with exon 18 mutations exhibited higher sensitivity to neratinib (by 25-fold for E709K, by 5-fold for G719A, and by a comparable extent for Del 18) than those expressing Del19. Western blot analyses showed that these differential sensitivities corresponded to different degrees of suppression of EGFR phosphorylation in HEK293 cells. Furthermore, analyses of the ACC and COSMIC databases clearly indicated that patients with lung cancers harboring G719X exhibited higher response rate to afatinib or neratinib (~80%) than to 1G TKIs (35-56%).

Conclusion:
Our data indicated that lung cancers harboring exon 18 mutations, although rare, should not be overlooked in clinical practice and that these cases are best treated with afatinib or neratinib, although the currently available in vitro diagnostic kits do not detect all exon 18 mutations.

Abstract not provided

Background:
Previous series have shown that clinical benefit with pemetrexed-based systemic therapy can be durable in patients with ALK- and ROS1-rearranged lung cancers. The benefit of pemetrexed-based treatment in RET-rearranged lung cancers relative to other genomic subsets has not been explored.

Methods:
A retrospective review of records of patients treated at Memorial Sloan Kettering between 2007-2014 was conducted. Eligibility criteria: pathologically-confirmed advanced (stage IIIB/IV) non-small cell lung carcinoma, treatment with pemetrexed as monotherapy or in combination with other systemic agents, documented evidence of a rearrangement involving RET, ROS1, or ALK, or a KRAS mutation. Screening for these alterations was performed via break apart fluorescence in situ hybridization, multiplex mutation hotspot testing (Sequenom), or next-generation sequencing (MSK-IMPACT, Illumina HiSeq). Progression-free survival (PFS) and time to progression (TTP) were calculated using Kaplan-Meier estimates from the date of initiation of pemetrexed-containing therapy, and overall survival (OS) from diagnosis of metastatic disease. Overall response rate (ORR, RECIST v1.1), PFS, TTP, and OS were compared between RET-rearranged lung cancers and control groups (ALK- and ROS1-rearranged and KRAS-mutant lung cancers).

Results:
Data from 104 patients (RET-rearranged n=17, ROS1-rearranged n=10, ALK-rearranged n=36, KRAS-mutant n=41) were evaluated. As expected, median pack-year cigarette smoking history significantly differed between groups (p<0.001): RET 0 (0-48 range), ROS1 0 (0-12), ALK 0 (0-74), KRAS 38 (0-93). Features such as line of pemetrexed therapy (first vs other, p=0.1186), type of therapy (platinum combination, non-platinum combination, vs single-agent, p=0.1435), and need for dose reduction (p=0.9772) did not differ between groups. ORR, TTP, PFS, and OS in RET-rearranged lung cancers were not significantly different compared to ALK- and ROS1-rearranged lung cancers, and improved compared to KRAS-mutant lung cancers (Table 1). Table 1. Clinical Outcomes of Pemetrexed-Based Therapy

	RET	ROS1	ALK	KRAS	p-value
ORR	45%	78%	50%	26%	0.0242
Median TTP (months)	NR (20-NR)	32 (14-NR)	NR	7 (5-14)	<0.001
ALK vs ROS1 vs RET (p=0.90); RET vs KRAS(p=0.009)
Median PFS	20 (10-NR)	23 (14-NR)	24 (15-38)	6 (5-9)	<0.001
ALK vs ROS1 vs RET (p=0.94); RET vs KRAS(p=0.002)
Median OS	NR (24-NR)	NR (24- NR)	37 (30-63)	16 (13-29)	<0.001
ALK vs ROS1 vs RET (p=0.43); RET vs KRAS(p=0.002)

Conclusion:
Clinical benefit with pemetrexed-based therapy in RET-rearranged lung cancers can be durable and is comparable to ALK- and ROS1-rearranged lung cancers. Outcomes in RET-, ROS1-, and ALK-rearranged lung cancers were improved compared to KRAS-mutant lung cancers. Mechanisms responsible for pemetrexed sensitivity in these subsets should continue to be explored. Driver-independent factors such as smoking history may contribute to clinical benefit.

Background:
Crizotinib (crz) is registered only for the treatment of patients (pts) with ALK-translocated lung cancer. Crz is also a MET inhibitor. MET is amplified in several malignancies. Activity of crz in MET amplified (+) tumors was explored as part of the French National Cancer Institute (INCa) AcSé program, including both access to tumor molecular diagnosis and an exploratory multi-tumor 2-stage design phase II trial. We report here results in pts with MET + NSCLC.

Methods:
MET analysis on formalin-fixed, paraffin-embedded tumor samples was proposed in 170 investigating centers and performed in 28 regional INCa molecular genetic centers. MET+ was explored by FISH in tumor samples showing an IHC score of ≥2+. Pts with a tumor showing > 6 MET copies, whatever the MET/CEN7 ratio, were eligible, providing they were not eligible for any other academic or industry trial evaluating another MET inhibitor. Study treatment consisted in crz 250 mg BID. The objective response rate (ORR) and disease control rate (DCR) were assessed every 8 weeks, using RECIST v1.1.

Results:
From Aug. 5, 2013 to Mar. 1, 2015, 25 pts with MET+ NSCLC were enrolled and received crz. Median age was 59 years (range 30–92). Forty-four percent were females, 92% had tumors of non-squamous histology, and 96% presented with metastatic disease at study entry. Median number of prior treatments was 2 (range 0 – 11). Eight pts were still on treatment at the cut-off date, 17 have stopped crz (15 progressive diseases (PD), 1 adverse event (AE), 1 patient’s choice). Among the 18 pts evaluable for response after 8 weeks, we observed 7 partial responses, 6 stable diseases and 5 PD, leading to an ORR of 39% [95% CI:17-64], and a DCR of72% [47-90]. DCR at 6 months was 22% (4 pts out of the 18 evaluable pts). Crz was well tolerated with only 5 grade ≥3 (2 AE + 3 SAEs) and 3 grade 1-2 SAEs. Most common AEs, mainly grade 1 or 2, were nausea (60% of pts), visual disorders (52%), anemia (52%), elevated transaminases (48%) and vomiting (40%).

Conclusion:
Nationwide biomarker-driven access to crz for pts with MET+ malignancy is feasible. Crz was well tolerated and showed responses in pretreated MET+ lung cancers. Survival data and duration of response will be presented.

Background:
Mutations in the MET exon 14 RNA splice acceptor and donor sites, which lead to exon skipping, deletion of the juxtamembrane domain, and loss of Cbl E3-ligase binding to the resultant aberrant MET protein, were previously reported to be oncogenic in preclinical models (Kong-Beltran, Cancer Res 2006). These mutations occur in 4% of lung adenocarcinomas but have not been clinically assessed (TCGA 2014). We now report responses to the MET inhibitors crizotinib and cabozantinib in patients with stage IV lung adenocarcinomas harboring mutations leading to MET exon 14 skipping.

Methods:
Patients with stage IV lung adenocarcinomas harboring MET exon 14 splice site mutations (N=6) or a mutation deleting Y1003 in exon 14 (N=1) were identified through a clinical assay based on hybrid capture/next-generation sequencing of 341 oncogenes and tumor suppressors (MSK-IMPACT). MET IHC was performed on archival FFPE tissue. RNA skipping was confirmed by NanoString. Radiographic response to MET inhibition was assessed using RECIST 1.1 and PERCIST criteria.

Results:
Clinicopathologic data for those treated (N=4) are in the table below:

ID	Age	Sex	Smoking status (pack years)	MET exon 14 variant	MET therapy	Response	MET IHC (H-score)
1	65	M	C (20)	MET p.V1001_F1007del (c.3001_3021delGTAGACTACCGAGCTACTTTT)	crizotinib (3rd line)	PR (-31%)	NA
2	80	M	F (20)	MET c.3024_3028delAGAAGGTATATT	crizotinib (3rd line)	PR (-30%)	300
3	90	F	N	MET c.3028G>C	crizotinib (3rd line)	PR (-47%)	NA
4	80	F	N	MET c.3028G>C	cabozantinib (3rd line)	SD (0%), CR (PERCIST)	300

To date, 3 patients have been treated with off-label crizotinib and 1 with cabozantinib (NCT01639508). Three of four patients (75%) developed a PR to treatment. The remaining patient had SD by RECIST, with PET imaging demonstrating a complete PERCIST response to treatment.

Conclusion:
MET exon 14 skipping is a novel oncogenic target that predicts for response to MET inhibitors. This appears to be a substantially better predictor of response than either protein expression or gene amplification. Patients with these splice site mutations should be treated on a clinical trial of a MET inhibitor. For those without access to a trial, use of off-label crizotinib should be considered.

Abstract not provided

Background:
Gene fusions involving the proto-oncogenes ALK, ROS1, RET and NTRK1 are established or potential drug targets in cancer. Although targeted kinase inhibitors induce significant tumor shrinkage, complete patient responses are rare, and it is from that residual tumor burden that drug resistant clones eventually emerge. We have previously shown a role for WT EGFR signaling in ROS1+ cancer cells and their drug resistant derivatives. We hypothesized that EGFR performs a similar role in cancer cells harboring other gene fusions.

Methods:
Fusion oncogene NSCLC cell lines were treated as described and analyzed through immunoblot analyses or fixed onto chamber slides and assayed using kinase-adaptor proximity ligation assays (PLA). FFPE from NSCLC patients treated at the University of Colorado Hospital were also analyzed using kinase-adaptor PLAs. Nu/nu mice were injected with fusion oncogene positive NSCLC cell lines, treated as described, and volumes were measured 3x/week. FFPE tumors from mice were analyzed using various immunohistochemical markers or kinase-adaptor PLAs.

Results:
Stimulation of NSCLC cells that harbor an oncogenic fusion with EGF not only increased downstream signaling, but also rapidly increased phosphorylation of the fusion kinase itself. Additionally, EGFR signaling can dictate the engagement of different downstream signaling effectors, diversifying the signaling and cell fate responses in certain cancer cells. Proximity ligation assays (PLA) were employed to visualize wild-type EGFR-GRB2 signaling complexes in NSCLC cells driven by an oncogenic fusion kinase. We observed two modes of EGFR-GRB2 complex formation, the first in unperturbed cells, and the second only when the fusion kinase was inhibited. The kinetics of the induction of EGFR-GRB2 signaling revealed EGFR can take over the signaling in these cells as quickly as 5 minutes, and this kinase inhibitor-induced rewiring can be reversed by simply washing out the drug, suggesting a preference for the fusion kinase in the signaling circuit of these cells. Analysis of fusion-positive patient samples acquired at the time of progressive disease from treatment with an oncogene targeted monotherapy revealed the presence of EGFR-GRB2 signaling complexes. Additional analyses of patient samples revealed evidence of potentially non-cell autonomous responses to these therapies that may enable the survival of cells that would otherwise be drug-sensitive. The combination of a fusion kinase inhibitor with anti-EGFR therapy provided superior blockage of EGFR and ALK signaling complexes, as well as improved reduction in tumor volume and prolonged survival in an ALK+ xenograft model.

Conclusion:
Collectively, these results demonstrate a previously unknown role for an unmutated kinase, EGFR, in modulating the oncogenic phenotype in cells addicted to oncogenic fusion kinases. The activation of the EGFR signaling pathway can quantitatively augment fusion kinase signaling, but also diversify it by regulating the engagement of alternate signaling effector proteins. This data provides evidence for a novel role for EGFR as an oncorequisite signaling partner in certain cancer cell populations that harbor an oncogenic fusion kinase. Combination therapy of a fusion kinase targeted inhibitor with anti-EGFR therapy may improve initial tumor cell killing, and delay or prevent the onset of drug resistance in these patient populations.

Background:
The biological heterogeneity of KRAS-mutant LUAC represents a major impediment to the successful implementation of targeted therapeutic strategies for this clinically challenging group of lung cancer patients. Through integrative, multi-platform analysis of large scale omics data we recently identified three major subsets of KRAS-mutant LUAC defined on the basis of co-occurring genomic alterations in STK11/LKB1 (KL subgroup), TP53 (KP) and CDKN2A/B (KC), the latter coupled with low expression of the TTF1 transcription factor. We further demonstrated subset-specific molecular dependencies, patterns of immune system engagement and therapeutic vulnerabilities. Here, we extend these findings through comprehensive analysis of a wide panel of KRAS co-mutations and assess the impact of key co-mutations on facets of the malignant phenotype including flux through the MAPK and PI3K/AKT pathways and heterotypic interactions with the host immune system.

Methods:
Our datasets consisted of 431 tumors from TCGA (122 KRAS-mutant), 41 additional chemo-naive KRAS-mutant LUACs (PROSPECT dataset) and 36 platinum-refractory KRAS-mutant LUACs from the BATTLE-2 clinical trial. Significant KRAS co-mutations were identified on the basis of a P value threshold of ≤0.05 (Fisher’s exact test) coupled with a baseline prevalence of ≥3%. RNASeq data were downloaded directly from the TCGA site. Expression profiling of PROSPECT tumors was performed using the Illumina Human WG-6 v3 BeadChip Array whereas BATTLE-2 tumors were profiled using the GeneChipâHuman Gene 1.0 ST Array from Affymetrix. Generation of MAPK and PI3K proteomic scores, based on Reverse Phase Protein Array (RPPA) data, has been previously reported.

Results:
Our analysis identified somatic mutations in 31 genes as significantly co-mutated with KRAS in LUAC samples. Among them, co-mutations in STK11/LKB1 (P=0.00011) and ATM (P=0.0004) predominated. Somatic mutations in ERBB4 (P=0.0059), encoding a member of the ErbB family of receptor tyrosine kinases and MAP3K4 (P=0.0017) were also enriched in KRAS-mutant LUAC. We assessed the impact of KRAS co-mutations on the amplitude and directionality of signaling downstream of mutant KRAS using the proteomic “MAPK score“ and “PI3K score” as surrogates of effector pathway activation. Interestingly, co-mutations in ERBB4 were associated with significantly suppressed flux through the MAPK pathway (P=0.0024, t-test). Somatic mutations in other genes, including CAMSAP2, were associated with suppressed signaling through both the MAPK (P=0.00876, t-test) and PI3K-AKT (P=0.0032, t-test) cascades. Finally, within KRAS-mutant tumors, co-mutations in NLRC5, a master transcriptional regulator of MHC Class I molecules were associated with reduced mRNA expression of several of its classical target genes. In addition, low mRNA expression of NLRC5 correlated strongly with reduced expression of key components of the antigen presentation pathway across multiple independent datasets of chemotherapy naïve and platinum refractory KRAS-mutant tumors and cell lines. Thus, in addition to cell autonomous effects, co-mutations can also impinge on the reciprocal relationship between malignant cells and their immune microenvironment.

Conclusion:
Our work identifies a compendium of KRAS co-mutations that impact classical and emerging cancer hallmarks, including evasion of the host immune response. Systematic interrogation of the functional impact of prevalent KRAS co-mutations is essential for the development of personalized treatment approaches for this heterogeneous group of tumors.

Background:
Mutations in genes of the KEAP1-NFE2L2 pathway in patients with NSCLC are associated with an increased tumor growth, resistance towards cytostatic drugs and reduced survival rates. KEAP1 suppresses NFE2L2 under physiological conditions. Oxidative stress or electrophiles cause NFE2L2 to stabilize and translocate to the nucleus, resulting in transcription of various cytoprotective genes. Mutations in KEAP1 and NFE2L2 are described for diverse tumor entities and often cause an increased level of NFE2L2 leading to resistance of cancer cells against anti-cancer drugs and irradiation. This study was performed to characterize KEAP1-mutated and NFE2L2-mutated NSCLC clinically and genetically.

Methods:
Tumor tissue collected from 446 patients within a regional screening network was analysed for KEAP1 mutations and NFE2L2 mutations using next-generation sequencing (NGS). Clinical, pathological and genetic characteristics of these patients are described and compared with a control group of patients without KEAP1 mutation and without NFE2L2 mutation.

Results:
So far, we identified 33 patients with KEAP1 mutations. Among these we found 34 different mutations, of which the majority was not previously described. KEAP1 mutations were not restricted to a special exon. In 30 patients (90.9%), additional driver aberrations in KRAS, EGFR, FGFR1, FGFR3, STK11, ALK, DDR2, HRAS, BRAF, PIK3CA, PTEN, NFE2L2, EP300, TSC1, CREBBP, NRAS, MET and Her2 could be detected, as well as mutations and polymorphisms in TP53. KEAP1 mutations occurred in both genders (male/female ratio 3/1), in squamous-cell carcinoma (36.4%) and adenocarcinoma (60.6%) and were significantly associated with smoking. We also identified 26 patients with NFE2L2 mutations. Among these we found 15 different mutations, of which W24R and E79K were the most common. In 20 patients (76.9%) additional driver aberrations were detected. NFE2L2 mutations occurred in squamous-cell carcinoma (69.2%) and adenocarcinoma (23.1%) and were significantly associated with smoking as well. NFE2L2 mutations also occurred in both genders with 61.5% male and 38.5% female. Two patients had both a KEAP1 mutation and a NFE2L2 mutation.

Conclusion:
Our data suggest a role of KEAP1-mutations and NFE2L2-mutations as a cofactor in addition to classical driver mutations underlying the malignant phenotype of lung cancer cells. So far, this is the largest cohort of patients with KEAP1-mutations and NFE2L2-mutations analysed and described. Further survival and treatment analyses will reveal the role of these mutations for the outcome of these patients.

Abstract not provided

Background:
The LACE-Bio group assessed the prognostic and predictive values of KRAS and p53 mutations in 1543 completely resected non-small cell lung cancer (NSCLC) tumors. The predictive value of combined KRAS/p53 mutations for survival benefit from adjuvant chemotherapy was evaluated on 49 patients and chemotherapy was deleterious in this group compared to observation (HR 2.49 CI 95% [1.10 – 5.66], p=0.03). Patients with tumors harboring combined KRAS/p53 mutations had a worse outcome when treated with adjuvant chemotherapy compared patient with double wild type (WT) tumors (HR 3.03 (95% CI [1.29 – 7.15], p=0.01, interaction p=0.06). We have compared the chemo-sensitivity of patient derived xenografts (PDXs) with double p53/KRAS mutations, single p53, single KRAS mutation or double WT. 0

Methods:
Surgically resected early stage lung adenocarcinomas (ADC) were implanted into non-obese diabetic severe combined immune deficient (NOD-SCID) mice. Fourteen lung ADC PDXs with various p53/KRAS status were revived and implanted: 11 engrafted and were expanded for comparison of treatment vs control. For each model, 6 replicates were included in treatment and control arms. Chemotherapy (cisplatin 3 mg/kg and vinorelbine 7 mg/kg intraperitoneally weekly) was initiated in the PDXs at tumor volumes of 150 mm[3].

Results:
Four models were p53/KRAS double mutant, 4 p53 mutant, 2 KRAS mutant and 1 double WT. The 4 double mutant PDXs responded to chemotherapy, 2 with reduced (SD) and 2 inhibited (PR) growth. Among the 4 PDXs with p53 mutation only, 2 responded (1 PR and 1 SD) and 2 were resistant. Among the 2 PDXs with KRAS mutation only, 1 had a complete response, but relapsed at treatment arrest and 1 achieved PR. The double WT PDX was highly sensitive to chemotherapy (PR) but also relapsed at treatment arrest.

Conclusion:
Among these 11 PDXs, the p53/KRAS mutation status did not predict chemo-sensitivity to cisplatin/vinorelbine, one of the most active adjuvant chemotherapy regimens in NSCLC. As these PDXs were molecularly profiled, we currently are investigating other biomarkers that might predict their sensitivity or resistance to chemotherapy.

Background:
Hippo signaling is actively involved in adult tissue homeostasis and cell fate determination. Previous studies have linked the activation of YAP (the major downstream effector of Hippo pathway) with LKB1 deficiency. Here, we characterize the function of YAP in the progression and phenotypic plasticity of LKB1-deficient lung tumors and decipher the detailed mechanisms underlying those process.

Methods:
Through integrative studies on human lung cancer specimens and lung cancer mouse models, we investigate the distinct role of YAP on lung cancer malignant progression and phenotypic transition. Furthermore, we uncover the detailed mechanisms by cell line based works together with biochemistry and molecular biology methods.

Results:
The oncogenic role of YAP in malignant progression of Lkb1-deficient lung adenocarcinoma Using distinct lung cancer mouse models, we show that ectopic expression of YAP in Type II alveolar epithelial cells results in hyperplasia in the lung. YAP expression significantly accelerates lung adenocarcinoma (ADC) malignant progression in Kras[G12D] mice whereas YAP deletion dramatically delays the process in Lkb1[L/L]/Kras[G12D] mice. Further mechanistic investigations have revealed that the delayed progression in Lkb1-deficient ADC with YAP ablation attribute to the downregulation of the inhibitor of apoptosis protein, Survivin. The inhibitory role of YAP in phenotypic transition from adenocarcinoma to squamous cell carcinoma We have previously shown LKB1 inactivation confers lung adenocarcinoma with strong plasticity to progressively change the cell fate and transit to squamous cell carcinoma with unknown mechanism. Here, we find that ectopic YAP overexpression dramatically inhibits ADC to SCC transdifferentiation whereas knockdown of YAP conversely accelerates the transition process. YAP is initially activated by LKB1 loss in ADC, leading to ZEB2 up-regulation in ADC cells, which binds to DNp63 gene promoter to repress DNp63 transcription. During the transition process, extracellular matrix (ECM) depletion in ADC inactivates YAP, thus relieves ZEB2 mediated default repression on DNp63 transcription in ADC, leading to the initiation of squamous differentiation program. Functionally, p63 ectopic expression significantly rescues the inhibitory effect of YAP upon SCC transdifferentiation.

Conclusion:
Our findings uncover the two faces of YAP in lung tumor malignant progression and phenotypic plasticity. YAP is an essential mediator of malignant progression of Lkb1-deficient lung ADC via regulating Survivin whereas an important barrier for lung cancer transdifferentiation through ZEB2 dependent DNp63 repression. Those works shed light on the fundamental role of YAP in regulating cancer progression and lineage phenotypic transition in LKB1 deficient lung tumors, which might help future development of better therapeutic strategies.

Abstract not provided

Background:
The tropomyosin-receptor kinase (TRK) family includes genes important in nervous system development, NTRK1 (N1), NTRK2 (N2) and NTRK3 (N3). Oncogenic activation was identified long ago as N1 fusions in colon cancer and numerous fusions have been recently identified affecting all family members in multiple tumor types. This study developed FISH reagents for molecular diagnosis of NTRK rearrangements and investigated their prevalence in NSCLC. The ultimate goal is to validate a clinical assay for selection of patients who may benefit from novel tyrosine kinase inhibitors (TKIs) targeting these fusion proteins.

Methods:
Three FISH break-apart (BA) probe sets (LDTs) were tailored for diagnosis of rearrangements in N1, N2 and N3 and tested in specimens with known genomic status for these genes: cell lines KM12 (N1), CUTO3 (N1), MO-91 (N3), xenograft CULC001 (N1), and clinical specimens, and used to screen resected NSCLC. The LSI NTRK1 Cen and Tel probes (Abbott Molecular) were also tested. A specimen was positive for individual rearrangement when ≥15% tumor cells had split or single 3’,5’ signals. Moreover, a 6-target, 2-color FISH probe including the 3’N1, 3’N2 and 3’N3 sequences labeled in red and the 5’N1, 5’N2 and 5’N3 sequences labeled in green (TRKombo) was designed for rapid screening of TRK rearrangements in clinical specimens.

Results:
Results were obtained in 443, 410, and 434 examined NSCLC and positive patterns were detected in 5, 5 and 1 specimens, respectively for N1, N2, and N3. These 11 positive patients had age ranging from 38y to 76y, gender 6 male:5 female, and were current (4), former (5) or never (2) smokers. Histology was predominantly adenocarcinoma (7) but also included squamous cell (3) and neuroendocrine morphology (1). Unique to the N1 assay was the observance of FISH signal fusions where the 5’N signals appeared as doublet in >20% of the NSCLC specimens, which was determined to be copy number variation due to segmental duplication. Other atypical patterns were observed for all three targets and included doublets of the FISH fusion signals (18%, 14% and 9% respectively) and gene clusters (~5% for each). Twenty specimens (pre-clinical models and clinical cases) characterized as positive by the LDT N1 and by next generation sequencing (NGS) or atypical by the LDT NTRK1 BA were blindly analyzed with the LSI NTRK1 probe set and the results were reproducible, with brighter intensity of the fluorescent signals for the LSI probe. These specimens (positive by FISH and several atypicals) are currently under investigation to characterize the sequence specific genomic rearranged region by using a custom targeted, capture-based NGS panel (NimbleGen, Roche). The TRKombo screening probe performed well in blinded experiment using validation set including pre-selected positive and negative specimens and is under testing in clinical tissue sections.

Conclusion:
N1, N2 and N3 fusions were detected by FISH in a subset of lung carcinomas including adeno, squamous and neuroendocrine tumors. Optimization of molecular panels for diagnosis of these rearrangements is relevant since they represent a sizeable number of cases across multiple tumor types and there are numerous targeted inhibitor agents under development.

Background:
PTPN11/Shp2 somatic mutations occur in 25% of Juvenile myelomonocytic leukemias (JMML) and less commonly in adult solid tumors. PTPN11/Shp2 activates the mitogen-activated protein kinase (MAPK) and the phosphatidylinositide 3-kinase (PI3K) pathways. Accordingly, PTPN11/Shp2 mutations were shown to sensitize leukemia cells to MEK and PI3K inhibitors.

Methods:
We applied mass-spectrometry based genotyping (Sequenom Inc., Germany) to DNA extracted from tumor and matched normal tissue of 356 NSCLC patients (98 adenocarcinomas and 258 squamous cell (SCC)). PTPN11/Shp2 constructs with mutations (E76A, A72D) were generated and stably expressed in IL-3 dependent BaF3 cells and NSCLC cell lines (H1703, H157). The acquisition of MAPK and PI3K pathways activation was evaluated using western blotting and reverse phase protein array (RPPA). PTPN11/Shp2 phosphatase activity was measured in whole cell protein lysates using Shp2 assay kit (R&D Systems).

Results:
Somatic PTPN11/Shp2 hotspot mutations occurred in 3 (3.1%) and 9 (3.4%) of adenocarcinomas and SCCs, respectively. Mutant PTPN11/Shp2, compared to PTPN11/Shp2 wild type, promoted ten-fold IL-3 independent BaF3 cell survival. BaF3, H1703, and H157 cells expressing mutant PTPN11/Shp2 exhibited increased PTPN11/Shp2 phosphatase activity, phospho-ERK1/2, and phospho-AKT levels. Sequencing of NSCLC cell lines revealed that NSCLC H661 cell line has a PTPN11/Shp2 activating mutation (N58S). H661 had significantly higher PTPN11/Shp2 phosphatase activity when compared to PTPN11 wild-type H1703 and Calu3 NSCLC cells. Since the biological functions of PTPN11/Shp2 are mediated through its phosphatase domain, we stably expressed the inactivating PTPN11/Shp2 phosphatase domain mutation (C459S) in H661, H1703 and H157 cells resulting in catalytically inactive PTPN11/Shp2. This led to decreased phospho-ERK1/2 levels in all three cell lines. Importantly, the inactivation of PTPN11/Shp2 resulted in decreased phospho-AKT levels in H661 cells (PTPN11-mutated) and had no effect on phospho-AKT levels in the PTPN11/Shp2-wild type H1703 and H157 cells. Taken together, this data suggests that PTPN11/Shp2 activating mutations are oncogenic in NSCLC cells. Moreover, these findings reveal that PTPN11/Shp2 mutations may selectively activate the PI3K pathway in NSCLC cells. Parental H661 (PTPN11-mutated, KRAS and PIK3CA-wild type), parental H1703 (PTPN11, KRAS and PIK3CA-wild type) and parental H157 (KRAS-mutated, PTPN11 and PIK3CA-wild type) cells were treated with the novel MEK (BAY86-9766) and PI3K (BAY80-6946) inhibitors. IC50 values (table 1) suggest that PTPN11-mutated NSCLC cells have modest sensitivity to MEK inhibitors and profound sensitivity to PI3K inhibitors.

Table 1 IC 50 valuse

Cell Line	BAY86-9766 (nM)	BAY80-6946 (nM)
H661	2880 ± 600	13 ± 4.7
H157	1450 ± 520	< 50% inhibition @ 200
H1704	< 50% inhibition @ 10000

Conclusion:
PTPN11/Shp2 demonstrates the in vitro features of a driver oncogene, and potentially represents a new target in NSCLC.

Abstract not provided

Background:
Amplifications and activating mutations in the c-MET proto-oncogene are known oncogenic drivers that have proven responsive to targeted therapy. Mutations causing skipping of MET exon 14 are also oncogenic, but less well characterized. We undertook comprehensive genomic profiling (CGP) of a large series of advanced cancers to further characterize MET exon 14 alterations.

Methods:
DNA was extracted from 40 microns of FFPE sections from 38,028 advanced cancer cases. CGP was performed on hybridization-captured, adaptor ligation based libraries to a mean coverage depth of >500x using three versions of the FoundationOne test. Hybridization capture baits for the MET gene were identical for all three versions of the test. Base substitution, indel, copy number alteration, and rearrangement variant calls were examined to identify those nearby to the splice junctions of MET exon 14. These genomic alterations were then manually inspected to identify those likely to affect splicing of exon 14, or delete the exon entirely.

Results:
221 cases harboring MET ex14 alterations were identified. These patients had a median age of 70.5 years (range 15-88), with 97 males and 124 females. The cases were lung carcinoma (193), carcinomas of unknown primary (15), brain glioma (6), and one each of adrenal cortical carcinoma, hepatocellular carcinoma, histiocytic sarcoma, renal cell carcinoma, rhabdomyosarcoma, skin merkel cell carcinoma, and synovial sarcoma. The majority were stage IV. Identification of this alteration has lead to treatment with MET inhibitors such as crizotinib, and to durable partial responses or better exceeding 3 months in histiocytic sarcoma (1), sarcomatoid lung carcinoma (1), and nsclc (1+). Multiple patients (5+) have initiated treatment on either crizotinib or MET inhibitors in clinical development, and additional outcome data will be reported. One patient with locally advanced unresectable disease harbored a MET exon 14 skipping alteration. On initiation with treatment with an MET inhibitor, symptomatic relief was observed in 3 days, radiographic response was observed at two weeks, and resection was performed 8 weeks after initiation of the MET inhibitor.

Conclusion:
MET exon 14 alterations define a hereto unrecognized population of advanced cancer cases, particularly in NSCLC. Multiple case reports demonstrate that these alterations confer sensitivity to multiple small molecule MET inhibitors. This finding expands the population of advanced NSCLC patients who can derive benefit from MET-targeted therapies.

Background:
The reported prevalence of MET gene amplification in non-small cell lung cancer (NSCLC) varies from 0-21% and clinical correlations are emerging slowly. In a well-defined NSCLC cohort of the ETOP Lungscape program, we explore the epidemiology, the natural history of MET amplification and its association with MET overexpression, overall survival (OS), relapse-free survival (RFS) and time to relapse (TTR).

Methods:
Resected stage I-III NSCLC, identified based on the quality of clinical data and FFPE tissue availability, were assessed for MET gene copy number (GCN) and expression analysis using silver in-situ hybridization (SISH) and immunohistochemistry (IHC), respectively, on TMAs (MET and centromere-specific probes; anti total c-MET antibody, clone SP44; Ventana immunostainer). MET amplification was defined as MET/centromere ratio ≥2 with average MET GCN ≥4, high MET GCN at two levels as ≥median CGN and ≥5 (irrespective of amplification) and MET IHC+ as 2+ or 3+ intensity in ≥50% of tumor cells. Sensitivity analysis to define the amplification’s thresholds was also performed. All cases were analysed at participating pathology laboratories using the same protocol, after successful completion of an external quality assurance (EQA) program.

Results:
Currently 2709 patients are included in the Lungscape iBiobank (median follow-up 4.8 years, 53.3% still alive). So far, 1547 (57%) have available results for MET GCN with amplification detected in 72 (4.7%; 95%CI: 3.6%, 5.7%) and high MET GCN (≥5) in 65 (4.2%; 95%CI: 3.2%, 5.2%). The median value of average MET GCN per cell is 2.3. IHC MET expression is available for 1515 (98%) of these cases, 350 (23%) of which are MET IHC positive [170 cases (49%) 3+, 180 (51%) 2+]. The median age, for the cohort of 1547 patients, is 66.2 years, with 32.8% women, and 13.5%, 29.7%, 54% never, current, former smokers, respectively. Stage distribution is: IA 23.6%, IB 24.6%, IIA 17%, IIB 12.1%, IIIA 20.9%, IIIB 1.8%, while 52.7%, are of adenocarcinoma and 40.0% of squamous histology. MET amplification and high MET GCN (≥5) are not significantly associated with any histological tumor characteristics or stage (multiplicity adjusted alpha: 0.005). High MET GCN (≥2.3) is less frequent in current smokers (38.3% vs. 55.6% for former or non-smokers, p<0.001). MET amplification and high MET GCN are significantly associated with IHC MET positivity (p<0.001 in all cases). MET amplification is present in 9.7% of IHC MET+ vs 3.1% of IHC MET- patients and high MET GCN (≥5) in 8.6% of IHC MET+ vs 2.8% of IHC MET- patients. MET amplification ranges from 0 to 16% between centers, while high MET GCN (≥5) and (≥2.3) from 0% to 12%, and 11.8% to 98.9%, respectively. MET amplification and both levels of high MET GCN are not associated with OS, RFS or TTR.

Conclusion:
The preliminary results for this large, predominantly European, multicenter cohort demonstrate that MET amplification assessed by SISH prevails in 4.7% of NSCLC, is associated with strong MET expression, and has no influence on prognosis. The large inter-laboratory variability in GCN despite EQA efforts may highlight a critical challenge of MET SISH analysis in routine practice.

Background:
Increases in MET copy number define an oncogenic driver state sensitive to MET inhibition (Camidge et al, ASCO 2014). However, the level at which the genomic gain is relevant remains uncertain. When testing is performed by fluorescence in situ hybridization (FISH), variable cut-points in both mean MET/cell and MET/CEP7 ratio have been used. Partially overlapping datasets from the Lung Cancer Mutation Consortium (LCMC1) and Colorado Molecular Correlates (CMOCO) Laboratory were explored for a distinct MET-copy number driven lung adenocarcinoma subtype.

Methods:
MET was assessed by FISH. Data from non-adenocarcinomas and EGFR mutant patients with acquired resistance to an EGFR inhibitor were excluded. Positivity criteria were mean MET/cell ≥5 (low ≥5-<6, intermediate ≥6-<7, high ≥7) or MET/CEP7 ≥1.8 (low ≥1.8-≤2.2, intermediate >2.2-< 5, high ≥5). MET metrics were compared by race, sex, smoking status, stage at diagnosis, number of metastatic disease sites, site of metastases, presence of other known drivers (EGFR, KRAS, ALK, ERBB2, BRAF, NRAS, ROS1 and RET), response to first line chemotherapy and overall survival using Fisher’s exact tests, chi-square tests, Spearman correlations and log-rank tests, as appropriate. Statistical significance was set at the 0.05 level without adjustment for multiple comparisons.

Results:
1164 unique adenocarcinomas were identified (60% female, 85% Caucasian, 66% ex/current smokers). MET/CEP 7 data was available on 1164 and mean MET/cell on 700. 52/1164 (4.5%) had MET/CEP7 ≥1.8 (48% female, 83% Caucasian, 69% smokers). 50/52 (98%) had ≥1 other oncogenic driver tested (25/50 (50%) positive). 113/700 (16%) had mean MET/cell ≥ 5 (57% female, 82% Caucasian, 58% smokers). 109/113 (96%) had ≥ 1 other oncogenic driver tested (73/109 (67%) positive). Among patients with ≥1 additional driver oncogene tested, alternate drivers in low, indeterminate and high categories of mean MET/cell were 44/60 (67%), 17/24 (70%) and 12/28 (43%) respectively and for MET/CEP7: 16/29 (55%), 9/18 (50%) and 0/4 (0%) respectively. MET positive with additional drivers were excluded from further analyses. Men exceeded women in MET/CEP7 (men 4% vs women 1.6%, p = 0.019) and mean MET/cell positive cases (men 9.6% vs women 5.4%, p = 0.058). 6.4% of adrenal metastasis cases were MET/CEP7 positive vs 2% all other sites, p=0.031. Mean MET/cell: 12% adrenal vs 5% other sites, p=0.082. MET/CEP7 or mean MET/cell positive and negative groups did not differ by other variables (p > 0.05).

Conclusion:
The proportion of ‘MET positive’ adenocarcinomas varies by definition and positivity cut-point. Mean MET/cell ≥5 defines nearly 4x more positives than MET/CEP7 ≥1.8 and no mean MET/cell positive category was free from overlap with other drivers. As only high MET/CEP7 had no overlap with other drivers, MET/CEP7 ≥ 5 is the clearest candidate for a pure MET-copy number driven state, however cases free from other drivers do exist at lower MET positivity levels. MET/CEP7 positive cases free from other known drivers are more likely to be male, but unlike other known oncogenic states, race and smoking status are not significant in determining positivity. MET positivity may have a specific biological phenotype, being more likely to present with adrenal metastases.

Background:
MET is a receptor tyrosine kinase with frequently activated signaling in lung cancers. Multiple studies indicate that MET overexpression correlates with poor clinical prognosis. Tumors with MET amplification and overexpression may respond better to MET inhibitors than tumors with low expression. The prevalence of MET overexpression in lung cancer cohorts has varied from 20%-80%, as has the proportion of patient’s testing positive for prospective clinical trials with entry based on MET overexpression. The Lung Cancer Mutation Consortium (LCMC) Pathologist Panel endeavored to standardize evaluation of MET protein expression with “Round Robin” conferences.

Methods:
508 FFPE non-small cell lung cancer specimens were stained by immunohistochemistry for MET protein expression (SP44 antibody, Ventana). Seven pathologists from LCMC sites with specialized training in MET scoring evaluated 78 Aperio-scanned images of MET-stained slides in two successive rounds of 39 different cases per round. The percentage of tumor cells with membranous and/or cytoplasmic staining at different intensities were evaluated with H-scores ranging from 0 to 300. Overall group and individual pathologist’s scores were compared with intraclass correlation coefficients (ICCs). Between rounds, a “Round Robin” teleconference was conducted to review discordant cases and improve consistency of scoring. Steps to improve scoring included: review of a Roche MET training document, sharing pictures of cases with concordant scores (Figure 1), and provision of H&E images for the second round to facilitate identification of tumor areas. Figure 1



Results:
The overall average MET H-score for the 78 cases was 165.3 (H-score range: 42.5-279.7). The average H-score was <125 for 14 specimens, 125-175 for 35 specimens, and >175 for 29 specimens. The overall group ICC comparing the consistency of H-scores from all 7 pathologists improved from 0.50 (95% confidence interval: 0.37-0.64, “fair” correlation) for the first scoring round to 0.74 (95% confidence interval: 0.64-0.83, “good” correlation) for the second round. A comparison of the individual pathologist’s ICCs demonstrated improved individual scoring consistency for all seven pathologists between rounds with an average of 0.64 (“moderate” correlation, range 0.43-0.76) for the first round and 0.82 (“almost perfect” correlation, range 0.75-0.93) for the second round.

Conclusion:
Development of standardized, reproducible strategies for evaluation of complex biomarkers, such as MET, are critical to clinical trial design. The consistency of scoring for MET protein expression and other biomarkers may be improved by continuous training and communication between pathologists with easy access to H&E images and other visual aids.

Abstract not provided

Background:
ALK-tyrosine kinase inhibitor (ALKi) is currently the standard precision therapy for advanced ALK(2p23)-rearranged (ALK+) non-small cell lung cancer (NSCLC), often with impressive primary responses. Nonetheless, acquired clinical resistance even in excellent/complete responders still develops ultimately with time; thus hampering long term benefits. Classic tumor rebiopsy studies that deciphered drug-resistance mechanisms focused on the “late phase” resistance at time of clinical progression in treated ALK+ NSCLC. These studies identified diverse pattern of drug-resistance mechanisms, including numerous non-dominant secondary drug-resistant ALK kinase mutations (e.g. C1156Y and L1196M), bypass signaling pathways (e.g. EGFR, KIT signaling), ALK gene amplification, and overexpression of microenvironmental factors (e.g. EGF, TGF-α, HGF). The mechanisms underlying the initial and early emergence of drug-resistance under precision therapy are poorly understood.

Methods:
EML4-ALK(+) H3122 and patient-derived ALKi acquired resistant biopsied-lung tumor tissue cells were used to investigate drug-escape mechanisms. Stem cell transcription factors QPCR array and RNA-sequencing profiling were performed on H3122 cells under ALKi up to day 14, compared with untreated and drug-washout controls. MTS cell viability assays using ALKis, in vitro and in vivo tissues QPCR assays, as well as in vivo xenograft IHC analyses were also performed. Patient-derived bronchoscopic biopsied NSCLC tissues (Ma0083) during ALKi resistance was procured and propagated in cell culture in accordance with approved institutional protocols.

Results:
We identified that H3122 cells displayed cell plasticity and can escape ALKi’s (TAE-684, crizotinib) remarkably early after precision therapy initiation, with augmented prosurvival signaling via upregulated autocrine TGFβ2 signaling, but not TGFβ1 or β3, as early as day 14 post-treatment. We validated using both in vitro and in vivo models the upregulated cascade of tumoral TGFβ2-HOXB3-mitochondrial priming during adaptive drug-escape. The early onset drug-resistant cells were marked by reversible autocrine TGFβ2-mediated transcriptome reprogramming with reversibly enhanced EMT-ness and cancer stemness. Moreover, RNA-seq findings strongly suggest a “reverse Warburg” cell state during adaptive drug-escape. The adaptive cellular plasticity was verified also in patient-derived bronchoscopic biopsied NSCLC tissues (Ma0083) with ALKi resistance. Interestingly, inhibiting mitochondrial priming using dual BCL-2/BCL-xL BH3-mimetics ABT-263 was effective to suppress early drug-escape, but not with the BCL-2-specific agent ABT-199, suggesting BCL-xL is a key target. Importantly, we also identified upregulated HOXB3 expression correlated with the early adaptive drug-resistance cell state, emerged through dynamic remodeling of EZH2/UTX in the polycomb repressive complex-2 (PRC-2). Deregulated EZH2/UTX epigenetic balance impacted the poised chromatin state of HOXB3 promoter H3K27me3/H3K4me3 histone marks. Early drug-escape cell state was correlated with suppressed EZH2 expression, at mRNA and also protein levels, in both in vitro and in vivo models. Finally, our results showed that specific EZH2 inhibitor GSK126 promoted ALKi drug-resistance, while UTX inhibitor GSK-J4 eradicated ALKi adaptive drug-resistance.

Conclusion:
Our study findings provide novel insights into the initial emergence and evolution of ALK precision drug-resistance and highlighted the significance of understanding the role of adaptive tumor cell plasticity in the early drug-escape process with important therapeutic implications. Therapeutic modulation of the coordinated EZH2/UTX balance in the PRC-2 complex can profoundly impact ALKi drug treatment outcome.

Background:
Acquisition of resistance to EGFR- tyrosine kinase inhibitors (TKIs) is one of important issues in lung cancer researches. Several resistance mechanisms have been identified. However, inter-tumor heterogeneity in acquisition of resistance to EGFR-TKIs is currently unclear.

Methods:
Eleven autopsied patients who developed acquired resistance to EGFR-TKI monotherapy were included in this study. All patients harbored activating EGFR mutations (exon 19 deletion or L858R mutation), and developed acquired resistance to EGFR-TKI after initial response to the drug. Details of patient characteristics are summarized in Table 1. The resistance mechanisms of seven patients have been reported in our previous analyses (Suda K, et al. Clin Cancer Res 2010, and Suda K, et al. APLCC 2014). In this study, we analyzed acquired resistance mechanisms in twenty-eight tumor samples obtained from the four additional patients using target sequencing technique by next-generation sequencer.

Results:
Among eleven patients, four developed T790M EGFR secondary mutation in all TKI-refractory lesions. One patient developed MET amplification in all TKI-refractory lesions. Three patients harbored both TKI-refractory lesions with T790M mutation and those with MET amplification. The other three patients showed respective resistance mechanisms (Table 1).

Table 1. Summary of resistant mechanisms in eleven patients.

Pt. ID	Age/Sex	Pack-Year	Resistant Mechanisms	TTF (m)
C1	57/F	0	T790M or MET	13.8
C2	48/F	0	T790M or MET	11.0
C3	58/M	34	MET	14.5
C4	75/M	0	T790M	43.9
C5	93/F	0	T790M	14.8
C6	62/M	26	T790M	9.1
P1	86/F	0	T790M	10.8
P2	72/M	27	T790M or MET	3.8
P3	89/F	0	EGFR loss with MET or Unknown	9.0
P4	84/F	0	Unknown	22.6
A1	76/F	0	SCLC transformation or T790M	5.0

In the target sequence analysis, allele count data were further analyzed in tumor samples with T790M mutation, and we observed diverse T790M/activating EGFR mutation allele ratio ranging from 2 – 51%. In the analysis for time to treatment failure (TTF), we observed longer TTF in patients who developed single resistance mechanism compared with those who developed multiple resistance mechanisms (Fig. 1; p = 0.055). Figure 1



Conclusion:
In this study, we observed qualitative heterogeneity and quantitative heterogeneity of T790M allele ratio in acquisition of resistance to EGFR-TKIs in lung cancers. Qualitative heterogeneity in resistance mechanisms would have a correlation with TTF of EGFR-TKIs.

Abstract not provided

Background:
Rictor (RPTOR independent companion of MTOR, complex 2) is a highly conserved protein and is a critical component for assembly and functionality of the mTORC2 complex. Alterations of the PI3K/mTOR/AKT pathway are hallmark of many cancer types, underscoring the potential important role of Rictor. The goal of our current study was to characterize the functional consequences of genomic alterations of Rictor in advanced refractory NSCLC. Our preliminary data suggest that Rictor alterations have the potential to, not only signal canonically (via activation of AKT), but also provide cancer cells with alternate, more advantageous oncogenic signaling via non-canonical mechanisms.

Methods:
We correlated genomic data (DNA next generation sequencing (NGS), Foundation Medicine, Inc) gene expression profiling, and clinical outcome in the context of the ongoing BATTLE-2 clinical trial of targeted therapies in chemo-refractory NSCLC(198 cases). We further (1) surveyed early stage NSCLC cases(230 cases) in The Cancer Genome Atlas (TCGA) database to perform two-way hierarchical clustering comparing gene expression profiling in amplified vs diploid cases; (2) utilized a single-nucleotide polymorphism array to select Rictor amplified and diploid NSCLC cell lines; (3) assessed Rictor protein and RNA expression by Western blot and qRT-PCR, respectively; (4) performed Rictor knockdown (siRNA), and (5) performed drug sensitivity to targeted therapies by MTS assay.

Results:
In the Battle-2 cases, we identified 15% of Rictor alterations (9% gene amplifications, 6.6% mutations, non-concomitant). Among the mutations, 1 was mapped to an N-terminal phosphorylation site, while all others are of unknown significance to date. Rictor alterations were significantly associated with lack of 8-week disease control in the AKTi+MEKi therapeutic arm. In the TCGA we found: (1) 10% Rictor amplifications and 3% mutations; (2) significant correlation between amplification and elevated Rictor gene expression; (3) a putative functional gene expression signature associated with Rictor amplification. In diploid cell lines we found concordance between AKT phosphorylation and activation of other downstream mTORC2 targets (i.e. SGK1 and PKCα), but in Rictor amplified cell lines we witnessed a discordant activation of these pathways. Furthermore, following Rictor knockdown in our amplified cell lines, a significant reduction of colony formation, migratory, and invasive potential was seen in a pathway-differential manner. Thus, suggesting that Rictor amplifications may provide survival advantage in select cancer cells by tipping the signaling balance toward a non-canonical oncogenic pathway (AKT-independent[I1] ).Also in a differential pathway manner, Rictor gene amplification and overexpression contributed to resistance to a number of targeted therapies

Conclusion:
Rictor alterations may constitute a potential novel mechanism of targeted therapy resistance via the activation of non-canonical signaling pathways. These alterations could define new molecular NSCLC subtypes with distinct biology that expose unique avenues for therapeutic implication. Ongoing studies are exploring therapeutic vulnerabilities, non-canonical signaling and Rictor mutations.

Background:
Adjuvant platinum-based chemotherapy remains a primary treatment of non-small-cell lung cancer (NSCLC); however, identification of predictive biomarkers is critically needed to improve the selection of patients who derive the most benefit. In this study, we hypothesized that decreased expression of SMARCA4/BRG1, a known regulator of transcription and DNA repair, is a predictive biomarker of increased sensitivity to platinum-based therapies in NSCLC. Moreover, this study also sought to confirm the prognostic role of SMARCA4/BRG1 in NSCLC.

Methods:
The prognostic value of SMARCA4 expression levels was tested using a microarray dataset from the Director’s Challenge Lung Study (n=440). Its predictive significance was determined using a gene expression microarray dataset (n=133) from the JBR.10 trial, and RT-PCR data from 69 patients enrolled on the MADe-IT trial and 33 platinum-treated patients from an institutional cohort.

Results:
In the Director's challenge study, low expression of SMARCA4 was found to be associated with poor overall survival compared to high and intermediate expression (P = 0.006). Upon multivariate analysis, compared to high, low SMARCA4 expression predicted an increased risk of death and confirmed its prognostic significance (HR=1.75; P=0.002). In the JBR.10 trial, improved five-year disease-specific survival was noted only in patients with low SMARCA4 expression when treated with adjuvant cisplatin/vinorelbine (HR 0.1, P= 0.001 (low); HR 1.1 , P= 0.762 (high)). An interaction test showed significance (P=0.007). In addition, a trend toward improved progression-free survival was noted only in patients with low SMARCA4 receiving a carboplatin- versus a non-carboplatin-based regimen in the MADe-IT trial. Figure 1 Fig1. Low SMARCA4 correlates with improved disease-specific survival with adjuvant cisplatin-based chemotherapy in the JBR.10 trial.



Conclusion:
Although decreased expression of SMARCA4/BRG1 is significantly associated with worse prognosis, it is a novel significant predictive biomarker for increased sensitivity to platinum-based chemotherapy in NSCLC patients.

Background:
Cisplatin is the backbone of chemotherapeutic treatment of lung cancer. Unfortunately the development of resistance has become a major challenge in the use of this cytotoxic drug. Understanding the mechanisms underlying this resistance phenotype may potentially result in the development of novel agents that may enhance the sensitivity of cisplatin chemotherapy in the clinical setting. The root of this resistance is hypothesized to be due to the presence of a rare cancer stem cell (CSC) population within the tumour that can reform a heterogenic tumour, resulting in recurrence and resistance following cisplatin chemotherapy.

Methods:
An isogenic model of cisplatin resistance was established by chronically exposing a panel of NSCLC cell lines (H460, SKMES, H1299) to cisplatin for 12months, thereby creating cisplatin resistant (CisR) sublines and their corresponding age-matched parental (PT) cells. To identify a CSC population within the resistant sublines, PT and CisR cell lines representing the three classifications of NSCLC were stained for ALDH1 using the Aldefluor kit (Stemcell Technologies). ALDH1 positive (+ve) and negative (-ve) subpopulations were isolated and their functional characteristics assessed. Proliferation and survival of ALDH1+ve fractions in response to cisplatin was assessed using BrdU and clonogenic survival assays relative to ALDH1-ve cells. ALDH1 subpopulations were examined for asymmetric division and expression of the human embryonic stem cell markers Nanog, Oct-4, Sox-2, Klf-4 and c-Myc and CD133. To confirm that this ALDH1+ve population is associated with cisplatin treatment, PT and CisR cells were chronically exposed to high dose cisplatin for 2 weeks and stained for ALDH1 and re-assessed for stemness qualities. Apoptosis and clonogenic survival of PT and CisR cells was assessed in response to selective inhibition of ALDH1 using diethylaminobenzaldehyde (DEAB) in combination with cisplatin. Xenograft studies in NOD/SCID mice are currently under investigation to examine the tumourigenic potential of isolated subpopulations of ALDH1.

Results:
A significant ALDH1+ve population was detected in CisR sublines, but not in their PT counterparts. Characterisation of the ALDH1+ve subpopulation confirmed enhanced expression of stemness markers, increased resistance and clonogenic survival in response to cisplatin compared to their ALDH1-ve counterparts, and the ability to asymmetrically divide. Chronic cisplatin treatment of the PT cell lines for 2 weeks increased resistance to cisplatin, increased stemness marker expression and induced the emergence of an ALDH1+ve population. Chronic high dose cisplatin treatment significantly expanded the ALDH1+ve population in the CisR cell lines. Importantly, inhibition of ALDH1 activity, with DEAB, decreased the mean cell viability, clonogenic survival capacity and increased cisplatin-induced apoptosis of the CisR cells when used in combination with cisplatin, an effect not seen in the PT cells.

Conclusion:
In this study, we have demonstrated the existence of a putative CSC population within our model of isogenic cisplatin resistant cell lines and suggest a role for ALDH1 inhibition as a potential therapeutic strategy in re-sensitizing chemoresistant lung cancer cells to the cytotoxic effects of cisplatin. Further studies will focus on re-purposing of FDA-approved ALDH1 inhibitor, Disulfiram (Antabuse), used in the treatment of chronic alcoholism as a potential combination therapy to prime chemoresistant cells to cisplatin.

Abstract not provided

Abstract not provided

Abstract not provided

Abstract not provided

Abstract not provided

Abstract not provided

Abstract not provided

Abstract not provided